Combretum edwardsii

Exell · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Combretaceae/Combretum

At a glance

Occurrence records88

Data sources8

Biological traits14

DNA specimens8

eDNA detections5

Sources8 archives

Databases and archives Combretum edwardsii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF88 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Combretum edwardsii, the Natal combretum or forest climbing bushwillow, is an uncommon forest plant endemic to the mistbelt region of eastern South Africa. It has a climbing habit and the stems may often lie prostrate on the forest floor or on cliff tops. As with some other Combretum species the leaves assume autumn colours before they are shed. The plant flowers in spring and the 4-winged fruits reach maturity in late summer.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max5 m

Plant height min2 m

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberobligatory

Elevation max1 435 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Combretum edwardsii has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes5

GenBank sequences8

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJX840543.1 ↗773 bp

ACGT

TCGCCGCCGACGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCG …

Combretum edwardsii voucher OM1584 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★rbcLa★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type88 records

Wild obs. + sensor16

Museum / vouchered72

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 10≤1 km 4

14 georeferenced · 2 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 72 records without

Open the institutions mapphysical evidence72

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban, ZA	31
Pretoria, ZA	24
Kew, GB	5
Cape Town, ZA	2
University of Johannesburglocation not on record	1
Claremont, US	1
KwaZulu-Natal Herbariumlocation not on record	1
WAGlocation not on record	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1
Saint Louis, US	1

10 institutions · 68 of 72 vouchered records shown · 4 without an institution code

09Environmental DNA5 detections

Where the DNA of Combretum edwardsii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 20.8–22.3

Seasonal swing summer↔winter9.00 °C

Max temp (day)25.6 °C 25.3–26.0

Min temp (night)15.8 °C 15.2–19.2

Precipitation100 mm/mo 69.7–118

Air humidity63.1 % 57.9–66.0

Moisture balance-37.0 mm/mo -81.2–-10.2

Vapour deficit913 Pa 904–1,047

Wind speed3.30 m/s 1.70–4.30

Cloud cover24.9 % 18.4–32.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)