Combretum caffrum

(Eckl. & Zeyh.) Kuntze · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Combretaceae/Combretum

At a glance

Occurrence records62

Data sources10

Biological traits14

DNA specimens8

eDNA detections5

Sources10 archives

Databases and archives Combretum caffrum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility62 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS · NPASS38 compounds

Occurrence & distributionGBIF62 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Combretum caffrum is the Eastern Cape South African bushwillow tree.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max9 m

Plant height min1 m

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max762 m

Elevation min15 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition38 compounds

Compounds documented for Combretum caffrum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Monomeric stilbenes32

Phenanthrenes5

Neolignans4

Flavones2

Documented compounds38 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Combretastatin	present	LOTUS
(13Z)-4-hydroxy-2,11-dioxatricyclo[13.2.2.13,7]icosa-3,5,7(20),13,15,17(1),18-hepten-10-one	present	LOTUS
(2R,4R)-13-hydroxy-3,6,15-trioxatetracyclo[14.2.2.110,14.02,4]henicosa-1(19),10(21),11,13,16(20),17-hexaen-7-one	present	LOTUS
2',3'-Diacetoxy-4'-Methoxy-(E)-Combretastatin A-1	present	NPASS
2',3'-Diacetoxy-4'-Methoxy-(Z)-Combretastatin A-1	present	NPASS
2,7-Phenanthrenediol, 9,10-dihydro-3,4,6-trimethoxy-	present	LOTUS
2-Methoxy-5-(2-(3,4,5-trimethoxyphenyl)ethenyl)phenol	present	LOTUS
2-methoxy-5-[(E)-2-(3,4,5-trimethoxyphenyl)vinyl]phenol	present	LOTUS
2-methoxy-5-[(E)-2-(7-methoxy-1,3-benzodioxol-5-yl)ethenyl]phenol	present	LOTUS
3,3',4-Tri-O-methylellagic acid	present	LOTUS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Combretum caffrum has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes5

GenBank sequences9

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJX840491.1 ↗724 bp

ACGT

TCGCCGCCGACGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCG …

Combretum caffrum voucher OM_MvdB11 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★rbcLa★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type62 records

Wild obs. + sensor14

Museum / vouchered48

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence48

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	32
Durban, ZA	5
MeiseBGlocation not on record	3
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	2
University of Johannesburglocation not on record	1
Cape Town, ZA	1

6 institutions · 44 of 48 vouchered records shown · 4 without an institution code

09Environmental DNA5 detections

Where the DNA of Combretum caffrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 12.8–19.3

Seasonal swing summer↔winter8.60 °C

Max temp (day)19.2 °C 17.0–24.3

Min temp (night)11.0 °C 7.50–14.8

Precipitation111 mm/mo 38.8–120

Air humidity59.2 % 52.2–62.3

Moisture balance-3.50 mm/mo -38.0–49.4

Vapour deficit720 Pa 651–866

Wind speed2.70 m/s 1.50–3.10

Cloud cover10.6 % 7.20–29.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)