Comaclinium montanum

(Benth.) Strother · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Comaclinium

At a glance

Occurrence records300

Data sources8

Biological traits11

DNA specimens19

eDNA detections7

Sources8 archives

Databases and archives Comaclinium montanum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility300 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF300 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI19 specimens

Genome at a glanceGoaTgenome

01Narrative

Comaclinium is a genus in the family Asteraceae, described as a genus in 1852.Scheidweiler, Michael Joseph François & Planchon, Jules Émile. 1852. Flore des Serres et des Jardins de l'Europe 8: 19-20. description in Latin, commentary in FrenchScheidweiler, Michael Joseph François & Planchon, Jules Émile. 1852. Flore des Serres et des Jardins de l'Europe 8: plate 756. color illustrationTropicos, Comaclinium Scheidw. & Planch. There is only one known species, Comaclinium montanum, native to Central America and to the State of Chiapas in southern Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass0.587 mg

Life cycle & reproduction1

Life formperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Comaclinium montanum has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes5

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJQ590615.1 ↗505 bpCosta Rica · 2011

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATATAAAACCAAGGATACTGATATCTTGGCAGCA …

Comaclinium montanum voucher BioBot11901 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL6★rbcLa★ITS★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Comaclinium montanum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type300 records

Wild obs. + sensor40

Museum / vouchered260

Range

Area of Occupancy AOO608 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 22≤1 km 5>10 km 3

30 georeferenced · 10 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 24>10 km 1

25 georeferenced · 235 without coordinates

Open the institutions mapphysical evidence260

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	82
National Biodiversity Institute, Costa Ricalocation not on record	55
Antiguo Cuscatlán, SV	35
Berlin, DE	20
Mexico City, MX	11
Kew, GB	9
Durango, MX	7
Area de Conservacion Guanacastelocation not on record	6
San José, CR	6
León, NI	6
Guatemala City, GT	3
Mexico City, MX	2
MEXUlocation not on record	2
Stockholm, SE	1
Tuxtla Gutiérrez, MX	1
Chicago, US	1
BMlocation not on record	1
HEMlocation not on record	1
Guatemala, GT	1
US	1
Universidad de El Salvadorlocation not on record	1

21 institutions · 252 of 260 vouchered records shown · 8 without an institution code

09Environmental DNA7 detections

Where the DNA of Comaclinium montanum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 23.1–23.4

Seasonal swing summer↔winter2.40 °C

Max temp (day)26.9 °C 26.0–27.9

Min temp (night)20.1 °C 19.9–20.2

Precipitation121 mm/mo 37.0–205

Air humidity66.3 % 63.4–69.2

Moisture balance-22.0 mm/mo -117–73.1

Vapour deficit958 Pa 865–1,052

Wind speed6.20 m/s 4.60–7.80

Cloud cover23.6 % 15.2–32.0

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)