Colutea arborescens
speciesAt a glance
Occurrence records23 455
Data sources11
Biological traits120
DNA specimens14
eDNA detections10
Sources11 archives
Databases and archives Colutea arborescens's data was compiled from.
GBIFGlobal Biodiversity Information Facility23 455 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics14 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements6 literature sources120 traits
Chemical compositionNPASS7 compounds
Occurrence & distributionGBIF23 455 records
Environmental DNA1 datasets · 2 countries10 detections
DNA & barcodingBOLD · NCBI14 specimens
Genome at a glanceCCDB · GoaT685 Mbp
02Traits & measurements
SourcesGIFTLEDAUSDATRYAusTraitsWCVP
Size & morphology9
Leaf mass65.79 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 1 467 mm² · GIFT: 1 467 mm²
Plant height3.88 m
⚠ sources differ — GIFT: 3.88 m · LEDA: 3.75 m · USDA: 2.44 m · TRY: 3.76 m
Plant height generative3.75 m
Plant height max4.5 m
Plant height min1.5 m
Seed mass15.71 mg
⚠ sources differ — TRY: 15.71 mg · LEDA: 18.64 mg · GIFT: 17.19 mg
Seed mass max20 mg
Seed mass min11 mg
Life cycle & reproduction35
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typehuman
⚠ sources differ — LEDA: ethelochor · GIFT: anemochorous
Flower colouryellow
Flower conspicuousYes
Flowering endAug
Flowering startMay
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formshrub
Life spanperennial
Lifespan categoryLong
Lifespan years10 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Reproduction asexualabsent
Resprout abilityYes
Seed number158
Seed spread rateSlow
Seedling vigorMedium
Self fertilizationabsent
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment29
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Fruit fleshinessdry
Fruit typecapsule
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: shrub · TRY: Tree, Shrub
Growth form USDAMultiple Stem
Habitat GIFTforestedges,mountains,parks
Hedge toleranceMedium
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min20 in
Shape and orientationErect
Small grainNo
Woodinesswoody
Physiology & chemistry22
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min150 days
Leaf dry-matter content (LDMC)244 mg/g
Moisture useMedium
Nitrogen fixation levelMedium
Photosynthetic pathwayC3
Precipitation max45 in
Precipitation min24 in
Protein potentialLow
Salinity toleranceLow
Shade toleranceMedium
Soil pH max8.5 pH
Soil pH min6 pH
Specific leaf area (SLA)14.95 mm²/mg
Temperature min-13 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound33 793 per lb
ToxicityNone
Veneer productNo
Other traits8
Diaspore typeseed
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousYes
Fruit seed persistenceNo
Height at 20yr2.44 m
Planting density max2 700 per acre
Planting density min700 per acre
03Chemical composition7 compounds
Compounds documented for Colutea arborescens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Furocoumarins $ Simple coumarins2
Polyene macrolides1
Furocoumarins1
Documented compounds7 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Bergapten | present | NPASS | |
| Colutequinone A | present | NPASS | |
| Colutequinone B | present | NPASS | |
| Imperatorin | present | NPASS | |
| Nystatin A1 | present | NPASS | |
| Phellopterin | present | NPASS | |
| R-Coluteol | present | NPASS |
05DNA & barcoding14 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Colutea arborescens has left across the world's sequence archives.
At a glance
DNA specimens14
Marker genes6
GenBank sequences10
eDNA detections10
Countries2
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGCTGAGGGCACGTCTGCCTGGGCGTCACATATC …
Colutea arborescens voucher SW93WEP 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL6★rbcLa★ITS3★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Colutea arborescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size684 600 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Colutea arborescens0.68 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records12–162n range16median16mode14records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1613×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +4
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — CORRIAS B. - 1980. Numeri cromosomici per la flora italiana:696-700.. Inform. Bot. Ital. , 12(2): 121-123.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · ipcn-api-dl — Baltisberger, M. 1988. Chromosomenzahlen einiger Pflanzen aus Albanien. II. Ber. Geobot. Inst. ETH Stiftung Rübel 54: 42–50.
CCDB · ipcn-api-dl — Vitek, E., M. Kiehn, K. Pascher, F. Starlinger, J. Greimler, U. Stocker, S. Lehner, P. Beinhofer & A. Blaha. 1992. Beiträge zur Flora von Österreich---weitere Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 129: 215–226.
CCDB · ipcn-api-dl — Corrias, B. 1980. Numeri cromosomici per la Flora Italiana: 696-700. Inform. Bot. Ital. 12: 121–123.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · CromoCat 2015 — Kuzmanov, B. (1978). Citotaxonomicno izsledvane na balgarski bobovi rastcnija. In: Evoljuclja na cvetnite rastenija i florogenez 1: 11-71.
CCDB · CromoCat 2015 — Kuzmanov, B. A. & Markova, T. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XL]. Taxon 22(2/3): 288-289.
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 829-842.
CCDB · CromoCat 2015 — Vitek, E., M. Kiehn, K. Pascher, F. Starlinger, J. Greimler, U. Stocker, S. Lehner, P. Beinhofer & A. Blaha (1992). Beiträge zur Flora von Österreich---weitere Chromosomenzählungen. Verhandlungen der Zoologisch-botanischen Gesellschaft in Wien 129: 215-22
2n 121×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type23 455 records
Wild obs. + sensor21 820
Museum / vouchered1 438
Cultivated / captive5
Other192
Origin
Native238
Introduced470
Range
Area of Occupancy AOO39 888 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy50% within 1 km
≤100 m 7 315≤1 km 1 527≤10 km 8 743>10 km 113
17 698 georeferenced · 4 122 without coordinates
Open the mapobservation + sensor21 820
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 63≤1 km 174≤10 km 221>10 km 11
469 georeferenced · 969 without coordinates
Open the institutions mapphysical evidence1 438
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy33% within 1 km
≤1 km 1≤10 km 2
3 georeferenced · 2 without coordinates
Open the mapnot free-living5
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions82 of 145 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 213 |
| LDlocation not on record | 108 |
| Berlin, DE | 102 |
| MeiseBGlocation not on record | 81 |
| Zürich, CH | 64 |
| València, ES | 45 |
| Zürich, CH | 41 |
| Adam Mickiewicz University in Poznańlocation not on record | 29 |
| BDBClocation not on record | 29 |
| Zhengzhou, CN | 28 |
| Wlocation not on record | 23 |
| Bern, CH | 23 |
| BClocation not on record | 23 |
| Denver, US | 21 |
| MAlocation not on record | 20 |
| Barcelona, ES | 20 |
| SLU Artdatabankenlocation not on record | 19 |
| CJBGlocation not on record | 18 |
| Riverside, US | 16 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 14 |
| BRNUlocation not on record | 13 |
| Moscow State Universitylocation not on record | 12 |
| Claremont, US | 11 |
| Oskarshamn, SE | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| Karlsruhe, DE | 10 |
| UGentlocation not on record | 9 |
| Chongqing Museumlocation not on record | 9 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 8 |
| Albuquerque, US | 8 |
| ESP003location not on record | 7 |
| South Kensington, GB | 7 |
| Bronx, US | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| WTUlocation not on record | 6 |
| Nanjing, CN | 6 |
| GZUlocation not on record | 5 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 5 |
| Mlocation not on record | 5 |
| Brussel, BE | 5 |
| University of Stellenboschlocation not on record | 5 |
| Provincia di Livornolocation not on record | 5 |
| Canadian Department of Agriculturelocation not on record | 5 |
| Wuzhou, CN | 5 |
| Görlitz, DE | 5 |
| Bourges, FR | 5 |
| BFLlocation not on record | 4 |
| Porrentruy, CH | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| San Diego, US | 4 |
| GJOlocation not on record | 4 |
| PRClocation not on record | 4 |
| Santa Barbara, US | 3 |
| Balochistan University of Information Technology, Engineering and Management Scienceslocation not on record | 3 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Logan, US | 3 |
| Davis, US | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| Salamanca, ES | 3 |
| Flagstaff, US | 3 |
| New Haven, US | 3 |
| DBF-NHMDlocation not on record | 3 |
| Frauenfeld, CH | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 3 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 3 |
| Nijmegen, NL | 3 |
| Salzburg, AT | 3 |
| Salvador, BR | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| JBCLMlocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| Staten Island, US | 2 |
| Fulda, DE | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| Moscow, US | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Podgorica, ME | 2 |
| Durham, US | 2 |
| Sion, CH | 2 |
| Cheney, US | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| Vitoria, ES | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| Bangkok, TH | 2 |
| NBSIlocation not on record | 2 |
| Phoenix, US | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Glarus, CH | 2 |
| Paris, FR | 2 |
| US | 2 |
| Northridge, US | 2 |
| Tilburg, NL | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Pittsburg, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| Chadron, US | 1 |
| Arcata, US | 1 |
| Portland, US | 1 |
| Turlock, US | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| JP | 1 |
| Beijing, CN | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Lausanne, CH | 1 |
| Alicante, ES | 1 |
| Millersville, US | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Irvine, US | 1 |
| Honolulu, US | 1 |
| OLAlocation not on record | 1 |
| Vancouver, CA | 1 |
| Ann Arbor, US | 1 |
| Córdoba, AR | 1 |
| BGBMlocation not on record | 1 |
| Brookings, US | 1 |
| Adelaide, AU | 1 |
| Uppsala, SE | 1 |
| BISHlocation not on record | 1 |
| BSBIlocation not on record | 1 |
| CJBNlocation not on record | 1 |
| Fribourg, CH | 1 |
| PrivatHerblocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| San Isidro, AR | 1 |
| Parkville, AU | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Boise, US | 1 |
| Frankfurt am Main | 1 |
| Porto Alegre, BR | 1 |
| Bloomington, US | 1 |
| Madrid, ES | 1 |
| Göteborg, SE | 1 |
| EL PASO, US | 1 |
| Edinburgh, GB | 1 |
| Long Beach, US | 1 |
| Dresden, DE | 1 |
| Trondheim, NO | 1 |
| BG-NMNHSlocation not on record | 1 |
| Uniwersytet Wrocławskilocation not on record | 1 |
| Pullman, US | 1 |
| Madrid, ES | 1 |
| Kew, GB | 1 |
145 institutions · 1 305 of 1 438 vouchered records shown · 125 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA10 detections
Where the DNA of Colutea arborescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.2 °C 18.6–20.0
Seasonal swing summer↔winter23.7 °C
Max temp (day)24.0 °C 23.5–25.2
Min temp (night)12.7 °C 11.8–15.8
Precipitation29.4 mm/mo 20.3–87.0
Air humidity36.3 % 35.8–58.8
Moisture balance-160 mm/mo -162–-59.7
Vapour deficit1,366 Pa 952–1,441
Wind speed3.90 m/s 3.60–4.40
Cloud cover22.9 % 22.3–39.4
CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.