Columnea sanguinolenta

(Klotzsch ex Oerst.) Hanst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Gesneriaceae/Columnea

At a glance

Occurrence records177

Data sources10

Biological traits11

DNA specimens9

eDNA detections3

Sources10 archives

Databases and archives Columnea sanguinolenta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility177 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF177 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Columnea sanguinolenta is a species of Gesneriaceae that is native to Colombia, Costa Rica, and Panama.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formepiphytic subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Elevation max1 090 m

Elevation min0 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Woodinessnon-woody

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Columnea sanguinolenta has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences2

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJQ592166.1 ↗527 bpCosta Rica · 2011

ACGT

AGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCA …

Columnea sanguinolenta voucher BioBot06409 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Columnea sanguinolenta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 91×CCDB · Cave1963

CCDB · Cave1963 — Sherk in Lee 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type177 records

Wild obs. + sensor16

Museum / vouchered161

Range

Area of Occupancy AOO368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 5

11 georeferenced · 5 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 1>10 km 1

3 georeferenced · 158 without coordinates

Open the institutions mapphysical evidence161

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	55
Saint Louis, US	47
University of Stellenboschlocation not on record	16
San José, CR	9
Area de Conservacion Guanacastelocation not on record	6
Durham, US	4
Kew, GB	4
Mexico City, MX	3
Museo Nacional de Costa Rica (MNCR)location not on record	2
CJBGlocation not on record	2
South Kensington, GB	2
BMlocation not on record	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
Kunming, CN	1
Chicago, US	1
HUAlocation not on record	1
Universidad de Antioquia (UdeA)location not on record	1

17 institutions · 156 of 161 vouchered records shown · 5 without an institution code

09Environmental DNA3 detections

Where the DNA of Columnea sanguinolenta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 24.3–24.2

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.9 °C

Min temp (night)22.1 °C

Precipitation418 mm/mo

Air humidity75.5 %

Moisture balance288 mm/mo

Vapour deficit743 Pa

Wind speed1.20 m/s

Cloud cover45.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)