Columnea querceti

Oerst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Gesneriaceae/Columnea

At a glance

Occurrence records338

Data sources10

Biological traits8

DNA specimens7

eDNA detections2

Sources10 archives

Databases and archives Columnea querceti's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility338 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF338 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Columnea querceti is a species of Gesneriaceae that is native to Costa Rica.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formhemiepiphytic subshrub

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formepiphyte

Woodinessnon-woody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Columnea querceti has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK326078.1 ↗617 bp

ACGT

TCGATACCTGCAAAGCAAACCCGCGAACACGTTCTCAACACTCTTGGGGTCGCGCCGTTGGATGCCTCTGTGCATCCCCCGTCGTGCTCC …

Columnea querceti voucher J L Clark 10047 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Columnea querceti carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 92×CCDB · book-ipcn67-71 · CCDB · Cave1963

CCDB · book-ipcn67-71 — DAVIDSE, G. 1970. In IOPB chromosome number reports XXV. Taxon 19: 102-113.~

CCDB · Cave1963 — Sherk in Lee 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type338 records

Wild obs. + sensor10

Museum / vouchered328

Range

Area of Occupancy AOO464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 1

4 georeferenced · 6 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 328 records without

Open the institutions mapphysical evidence328

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	140
Museo Nacional de Costa Rica (MNCR)location not on record	75
Saint Louis, US	65
Kew, GB	14
University of Stellenboschlocation not on record	12
San José, CR	11
Mexico City, MX	3
Area de Conservacion Guanacastelocation not on record	2
Berlin, DE	1
Chicago, US	1

10 institutions · 324 of 328 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Columnea querceti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.3 °C 24.3–24.3

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.8 °C 27.3–28.2

Min temp (night)21.2 °C 20.8–21.6

Precipitation131 mm/mo 42.8–220

Air humidity65.2 % 62.1–68.2

Moisture balance-20.0 mm/mo -110–70.1

Vapour deficit1,057 Pa 966–1,148

Wind speed5.10 m/s 4.10–6.00

Cloud cover26.9 % 17.5–36.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)