Colpothrinax wrightii

Schaedtler · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Colpothrinax

At a glance

Occurrence records30

Data sources6

Biological traits25

DNA specimens5

eDNA detections5

Sources6 archives

Databases and archives Colpothrinax wrightii's data was compiled from.

GBIFGlobal Biodiversity Information Facility30 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF30 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Fruit length12.5 mm

Fruit width12.5 mm

Fruit width max15 mm

Fruit width min10 mm

Leaf length max1 160 mm

Plant height8 m

⚠ sources differ — GIFT: 8 m · TRY: 15 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourblack

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits6

Dbh max50 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max1 500 cm

Shoot orientationerect

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Colpothrinax wrightii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences5

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMG437570.1 ↗1 359 bp

ACGT

TGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACGAAACCAAAGATACTGATATCTTGGCAGCATTCCG …

Colpothrinax wrightii voucher R. Racine 41 (FTG) ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★trnL-F

plant barcode

08Occurrence & distribution

Record type30 records

Wild obs. + sensor27

Museum / vouchered3

Range

Area of Occupancy AOO116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy4% within 1 km

≤1 km 1>10 km 26

27 georeferenced

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Miami, US	2

1 institutions · 2 of 3 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Colpothrinax wrightii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–7.40

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C

Min temp (night)3.00 °C

Precipitation344 mm/mo

Air humidity64.9 %

Moisture balance263 mm/mo

Vapour deficit428 Pa

Wind speed2.90 m/s

Cloud cover44.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)