Colona auriculata — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Colona

At a glance

Occurrence records30

Data sources5

Biological traits7

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Colona auriculata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF30 records

DNA & barcodingNCBIsequences

01Narrative

Colona auriculata is a shrub species first described by Desfontaines, with its current name after Craib; the genus Colona is in the family Malvaceae and now placed in the subfamily Grewioideae. No subspecies are listed in the Catalogue of Life. The species is distributed in Indonesia and throughout Indochina; in Vietnam it is frequently found in the provinces of and between Dong Nai and Ba Ria - Vung Tau its common name is bồ an. The roots are used in Cambodia to make antipyretic herbal medicines.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Dispersal typeunspecialized

Life formshrub or tree

Life spanperennial

Habitat & environment3

Climatewet tropical

Growth formtree

⚠ sources differ — GIFT: tree · TRY: shrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Colona auriculata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLAB925804.1 ↗531 bpCambodia · 2011

ACGT

GTTAAAGAGTATAAATTAACTTATTATACTCCTGAATATGAAGTCAAAGATACTGATATCTTGGCAGCCTTCCGAGTAACTCCTCAACCC …

Colona auriculata chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds, specimen_voucher: KYUM<JPN>:1020

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2rbcL2

plant barcode

08Occurrence & distribution

Record type30 records

Museum / vouchered30

Range

Area of Occupancy AOO72 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 30 records without

Open the institutions mapphysical evidence30

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	5
Kew, GB	3
Stockholm, SE	2
Paris, FR	1

4 institutions · 11 of 30 vouchered records shown · 19 without an institution code