Colocasia fallax

Schott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Colocasia

At a glance

Occurrence records65

Data sources11

Biological traits11

DNA specimens9

eDNA detections9

Sources11 archives

Databases and archives Colocasia fallax's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility65 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF65 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Colocasia fallax, the silver leaf dwarf elephant ear or dwarf taro, is a species of flowering plant in the family Araceae, native to the Indian Subcontinent, Tibet and Yunnan in China, and mainland Southeast Asia. A spreading perennial with attractive foliage reaching at most , it has found use as a houseplant, and as garden plant in USDA zones 8 through 10. Prefering wet conditions and high humidity, it is best suited for pond edges, water gardens and similar applications.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatesubtropical

Climberself-supporting

Elevation max900 m

Elevation min900 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Colocasia fallax has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences10

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPV938546.1 ↗406 bpIndia · 2023

ACGT

AAGTAGATCGCGTATGATCTGTATCTTTGAACGCAAGTTGCGCCCGAGGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCACG …

Colocasia fallax cultivar Colocasia fallax, Assam 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Colocasia fallax carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–422n range28median28mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 283×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Cao, L. m. & C.-l. Long. 2004. Chromosome numbers of eight Colocasia taxa and karyotypes of five species occurring in China. Acta Bot. Yunnan. 26(3): 310–316.

CCDB · ipcn-api-dl — Cao, L. m. & C.-l. Long. 2006. Karyotypes of two Colocasia (Araceae) species. Guihaia 26(2): 192–193.

CCDB · eflora

2n 422×CCDB · book-ipcn67-71 · CCDB · book-indian_vol2

CCDB · book-ipcn67-71 — LARSEN, K. 1969. Cytology of Vascular Plants III. A study of Thai Aroids. In "studies in the Flora of Thailand". Dansk Bot. Ark. 27: 39-59.

CCDB · book-indian_vol2 — Larsen, K. 1969

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type65 records

Wild obs. + sensor3

Museum / vouchered57

Other5

Origin

Native5

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 57 records without

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	8
Kunming, CN	8
Kew, GB	5
University of Stellenboschlocation not on record	3
Saint Louis, US	3
Guilin, CN	1
Kathmandu, NP	1
Bronx, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Mississippi State, US	1
Institut de Biologia Evolutiva, (CSIC-UPF)location not on record	1
Rotorua, NZ	1

12 institutions · 34 of 57 vouchered records shown · 22 without an institution code

09Environmental DNA9 detections

Where the DNA of Colocasia fallax was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C

Min temp (night)19.3 °C

Precipitation109 mm/mo

Air humidity52.0 %

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa

Wind speed1.80 m/s

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)