Colobanthus quitensis

(Kunth) Bartl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Colobanthus

At a glance

Occurrence records1 231

Data sources13

Biological traits21

DNA specimens1

eDNA detections16

Sources13 archives

Databases and archives Colobanthus quitensis's data was compiled from.

WikipediaWikimedia Foundation15 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 130 records↗

OBISOcean Biodiversity Information System101 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF · OBIS1 231 records

Environmental DNA2 datasets · 1 countries16 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT · NCBI685 Mbp

01Narrative

Colobanthus quitensis, the Antarctic pearlwort, is one of two native flowering plants found in the Antarctic region. It has yellow flowers and grows about 5 cm (two inches) tall, with a cushion-like growth habit that gives it a moss-like appearance.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.079 mg

⚠ sources differ — TRY: 0.079 mg · GIFT: 0.1 mg

Seed mass max0.1 mg

Seed mass min0.1 mg

Life cycle & reproduction5

DeciduousnessN

Dispersal typewind

Life formperennial or subshrub

Life spanperennial

Reproduction asexualpresent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Elevation max4 450 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry4

Leaf n22.33 mg/g

Leaf p4.8 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)10 mm²/mg

03Chemical composition2 compounds

Compounds documented for Colobanthus quitensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cinnamic acids and derivatives2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
trans-Ferulic acid		present	LOTUS
trans-p-Coumaric acid		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Colobanthus quitensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences10

eDNA detections16

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMT415604.1 ↗536 bpUnited Kingdom

ACGT

AACCTGCTTAGCAGAACGACCAGCGAACATGTTTACAACCCACGGGCGTAGGGTGTGGGTAGGTGCCTTGTGTGCTTGCTTGCCCCTTGC …

Colobanthus quitensis isolate AAS659 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS9

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Colobanthus quitensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size684 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Colobanthus quitensis0.68 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 80 n = 40

Ploidy2× / 4× cytotypes

Chromosome records80–802n range80median80mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 803×GoaT · Kew Plant DNA C-values Database · CCDB · kew · CCDB · iapt

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Bennett MD, Smith JB, Lewis Smith RI. 1982. DNA amounts of angiosperms from the Antarctic and South Georgia. Environmental and Experimental Botany 22: 307-318.

CCDB · iapt — IAPT/IOPB Chromosome Data 30

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type1 231 records

Wild obs. + sensor277

Museum / vouchered954

Origin

Native7

Range

Area of Occupancy AOO1 884 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 101≤1 km 112≤10 km 13>10 km 1

227 georeferenced · 50 without coordinates

Open the mapobservation + sensor277

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 9≤1 km 47≤10 km 75>10 km 3

134 georeferenced · 820 without coordinates

Open the institutions mapphysical evidence954

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
AASlocation not on record	139
British Antarctic Surveylocation not on record	53
Kew, GB	41
Saint Louis, US	12
Corrientes, AR	11
Xiamen, CN	11
Aarhus, DK	9
Edinburgh, GB	7
Universidad Nacional de Colombia (UNAL)location not on record	7
Mexico City, MX	6
Córdoba, AR	6
San Isidro, AR	6
PRClocation not on record	5
UnBlocation not on record	5
Uniwersytet Warszawskilocation not on record	5
Christchurch, NZ	5
Quito, EC	4
Auckland, NZ	4
Buenos Aires, AR	3
Museo Entomologico de Leonlocation not on record	3
Ciudad Autónoma de Buenos Aires, AR	3
Trondheim, NO	2
Turku, FI	2
New Haven, US	2
LDlocation not on record	2
La Paz, BO	2
Universidad de Antioquia (UdeA)location not on record	1
Görlitz, DE	1
Göteborg, SE	1
UFMSlocation not on record	1
Chicago, US	1
Olocation not on record	1
Paris, FR	1
MAlocation not on record	1
Bronx, US	1
Wlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
JBRJlocation not on record	1
ASUlocation not on record	1
East Lansing, US	1
Durango, MX	1
University of Montpellierlocation not on record	1

42 institutions · 371 of 954 vouchered records shown · 482 without an institution code

09Environmental DNA16 detections

Where the DNA of Colobanthus quitensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median1.20 °C 1.20–1.20

Seasonal swing summer↔winter6.10 °C

Max temp (day)1.80 °C

Min temp (night)0.8 °C

Precipitation63.2 mm/mo

Air humidity71.0 %

Vapour deficit194 Pa

Cloud cover49.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Colobanthus quitensis

At a glance

Sources13 archives

Size & morphology3

Life cycle & reproduction5

Diet & foraging1

Habitat & environment8

Physiology & chemistry4

Compound class profile1 class

Documented compounds2 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type1 231 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions25 of 42 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 231 records