Colobanthus kerguelensis

Hook.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Colobanthus

At a glance

Occurrence records117

Data sources5

Biological traits13

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Colobanthus kerguelensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility117 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources13 traits

Occurrence & distributionGBIF117 records

DNA & barcodingNCBIsequences

01Narrative

Colobanthus kerguelensis is a low-growing, moss-like flowering cushion plant in the family Caryophyllaceae, found on subantarctic islands in the southern Indian Ocean. The specific epithet refers to the type locality – the Kerguelen Islands.Flora of Australia Online.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology2

Leaf size60.44 mm²

Plant height0.009 m

Life cycle & reproduction4

Dispersal typewind

Life formperennial or subshrub

Life spanperennial

Sex typehermaphrodite

Habitat & environment5

Climatetemperate

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)229 mg/g

Specific leaf area (SLA)11.72 mm²/mg

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Colobanthus kerguelensis has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMN640382.1 ↗535 bpFrench Southern and Antarctic Lands

ACGT

AACCTGCTTAGCAGAACGACCAGCGAACATGTTTACAACCCACGGGCGTAGGGTGCGGGTAGGTGCCTTGTGTGCTTGCTTGCCCCTTGC …

Colobanthus kerguelensis isolate Crozet_Isl_AAS_3418 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type117 records

Wild obs. + sensor14

Museum / vouchered89

Cultivated / captive2

Other12

Origin

Native5

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 7>10 km 4

11 georeferenced · 3 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 2≤1 km 23≤10 km 4>10 km 1

30 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence89

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	30
Hobart, AU	18
AADClocation not on record	7
Mount Annan, AU	5
Wellington, NZ	5
AASlocation not on record	4
Palmerston North, NZ	4
Adam Mickiewicz University in Poznańlocation not on record	3
Museo Entomologico de Leonlocation not on record	2
Canberra, AU	2
Olocation not on record	1
Auckland, NZ	1
Saint Louis, US	1

13 institutions · 83 of 89 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)