Colobanthus acicularis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Colobanthus

At a glance

Occurrence records417

Data sources5

Biological traits10

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Colobanthus acicularis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility417 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF417 records

DNA & barcodingNCBIsequences

01Narrative

كولوبنط إبري هو نوع من النباتات يتبع جنس الكولوبنط من الفصيلة القرنفلية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction2

Deciduousnessevergreen

Life formperennial or subshrub

Habitat & environment4

Climatetemperate

Growth formForb

Mycorrhiza typenon-mycorrhizal

Woodinessnon-woody

Physiology & chemistry4

Leaf dry-matter content (LDMC)396 mg/g

Leaf n6.84 mg/g

Leaf p1.25 mg/g

Specific leaf area (SLA)11.31 mm²/mg

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Colobanthus acicularis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMT415560.1 ↗712 bpNew Zealand

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCTTAGCAGAACGACCAGCGAACATGTTTACAACCCACGG …

Colobanthus acicularis isolate Sab80 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type417 records

Wild obs. + sensor171

Museum / vouchered246

Range

Area of Occupancy AOO1 224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 103≤1 km 33≤10 km 8>10 km 4

148 georeferenced · 23 without coordinates

Open the mapobservation + sensor171

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 2≤1 km 3≤10 km 3>10 km 3

11 georeferenced · 235 without coordinates

Open the institutions mapphysical evidence246

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	140
Wellington, NZ	70
Auckland, NZ	26
Museo Entomologico de Leonlocation not on record	4
Chicago, US	2
Flagstaff, US	1
Hobart, AU	1
Rotorua, NZ	1
LDlocation not on record	1

9 institutions · 246 of 246 vouchered records shown