Collinsonia anisata

Sims · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Collinsonia

At a glance

Occurrence records188

Data sources4

Biological traits9

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Collinsonia anisata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility188 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF188 records

DNA & barcodingNCBIsequences

01Narrative

كولنسونية أنيسونية هي نوع من النباتات تتبع جنس الكولنسونية من الفصيلة الشفوية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Collinsonia anisata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKY552484.1 ↗614 bpUSA

ACGT

AAACCTGCAAAGCAGACCGTGAACACGTGTTTAACATCACCGGGCACGGTGCGGGGAGACTCACGCCGTGTACCACCCCCGCCGGTGCGC …

Collinsonia anisata voucher 16469 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type188 records

Wild obs. + sensor158

Museum / vouchered30

Range

Area of Occupancy AOO500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 87≤1 km 18≤10 km 4>10 km 21

130 georeferenced · 28 without coordinates

Open the mapobservation + sensor158

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	8
GAlocation not on record	5
Tuscaloosa, US	5
AUAlocation not on record	5
Valdosta State Universitylocation not on record	3
EL PASO, US	1
Bronx, US	1
Tall Timbers Research Stationlocation not on record	1
US	1

9 institutions · 30 of 30 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)