Collinsia torreyi

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Collinsia

At a glance

Occurrence records616

Data sources10

Biological traits13

DNA specimens4

eDNA detections5

Sources10 archives

Databases and archives Collinsia torreyi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility616 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF616 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 42

01Narrative

Collinsia torreyi is a species of flowering plant in the plantain family known by the common name Torrey's blue-eyed Mary. It is native to California and adjacent sections of Oregon and Nevada, where it grows in the coniferous forests of several mountain ranges, including the Sierra Nevada. This is an annual herb producing a slender, reddish stem up to about 25 centimeters tall. The inflorescence is a densely glandular array of flowers arising on pedicels. The corolla is no more than a centimeter long and two white or lavender-tinted upper lobes and three darker lavender to purple lower lobes. There are several varieties: C. t. var. brevicarinata - known from the Sierra Nevada and San Gabriel Mountains of California C. t. var. latifolia - known from northern California and southern Oregon C. t. var. torreyi - known from California and western Nevada C. t. var. wrightii (syn. Collinsia wrightii), limited to California and western Nevada

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass2.29 mg

Seed mass max2.3 mg

Seed mass min2.3 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Collinsia torreyi has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHQ652984.1 ↗569 bpUSA

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACACGTTTACAAACATACCGGGGGCCGAGGCACGATCGCAAGGTCGCTCGTCGAGGCCCTCTAA …

Collinsia torreyi voucher E.C. Neese 21345 (JEPS) clone 3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Collinsia torreyi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 421×CCDB · Cave1958

CCDB · Cave1958 — Garber- 1958a,b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~10.4 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin10.4 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type616 records

Wild obs. + sensor419

Museum / vouchered197

Origin

Native13

Range

Area of Occupancy AOO1 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 214≤1 km 46≤10 km 25>10 km 10

295 georeferenced · 124 without coordinates

Open the mapobservation + sensor419

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 2≤1 km 61≤10 km 40>10 km 3

106 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence197

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Riverside, US	33
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	18
Davis, US	15
Claremont, US	14
Arcata, US	11
Angwin, US	10
Pullman, US	8
San Jose, US	7
San Diego, US	7
San Luis Obispo, US	6
Bloomington, US	6
Canadian Department of Agriculturelocation not on record	6
Fredericton Stock Culture Collectionlocation not on record	6
CASlocation not on record	5
Northridge, US	4
Santa Barbara, US	4
US	3
Flagstaff, US	3
Truckee, US	3
WTUlocation not on record	2
New Haven, US	2
Columbia, US	2
ASUlocation not on record	2
Turlock, US	1
Bronx, US	1
San Francisco, US	1
KNFSClocation not on record	1
Beijing, CN	1
Ashland, US	1
Chadron, US	1
Wuzhou, CN	1
Logan, US	1
Henderson, US	1
Bangkok, TH	1
Mississippi State, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1

36 institutions · 190 of 197 vouchered records shown · 7 without an institution code

09Environmental DNA5 detections

Where the DNA of Collinsia torreyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)