Collinsia tinctoria

Hartw. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Collinsia

At a glance

Occurrence records1 157

Data sources11

Biological traits13

DNA specimens25

eDNA detections25

Sources11 archives

Databases and archives Collinsia tinctoria's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 157 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF1 157 records

Environmental DNA1 datasets · 0 countries25 detections

DNA & barcodingBOLD · NCBI25 specimens

Genome at a glanceCCDB · GoaT2.7 Gbp

01Narrative

Collinsia tinctoria is a species of flowering plant in the family Plantaginaceae known by the common names sticky Chinese houses and tincture plant. It is endemic to California, where it grows in the woodlands and forests of the mountain ranges of the central and northern regions of the state.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.8 mg

Seed mass max1.82 mg

Seed mass min1.8 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Collinsia tinctoria has left across the world's sequence archives.

At a glance

DNA specimens25

Marker genes3

GenBank sequences10

eDNA detections25

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF385346.1 ↗556 bp

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACATGTTTACAAACATACTGGGGACCGAGGCACTTGCCGAGGCCCTCTAACTAAACCCCGGCGC …

Collinsia tinctoria internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK9★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Collinsia tinctoria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 738 400 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Collinsia tinctoria2.74 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidy2× diploid · measured

Chromosome records14–142n range14median14mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 144×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn67-71 · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-ipcn67-71 — MEHRA, R-C., & K-S. RAI- 1970. Cytogenetic studies of meiotic abnormalities in Collinsia tinctoria. I. Chromosomal stickiness. Canad. J. Genet. Cytol. 12: 560-569.

CCDB · kew — Greenlee JK, Rai KS, Floyd AD. 1984. Intraspecific variation in nuclear DNA content in Collinsia verna Nutt (Scrophulariaceae). Heredity 52: 235-242.

n 71×CCDB · Cave1956

CCDB · Cave1956 — Garber

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 157 records

Wild obs. + sensor804

Museum / vouchered353

Origin

Native18

Range

Area of Occupancy AOO2 364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 432≤1 km 78≤10 km 46>10 km 41

597 georeferenced · 207 without coordinates

Open the mapobservation + sensor804

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 9≤1 km 100≤10 km 102>10 km 5

216 georeferenced · 137 without coordinates

Open the institutions mapphysical evidence353

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	38
Riverside, US	27
Claremont, US	24
San Diego, US	16
Santa Barbara, US	14
Davis, US	13
Canadian Department of Agriculturelocation not on record	11
Angwin, US	10
US	9
Fredericton Stock Culture Collectionlocation not on record	6
CASlocation not on record	5
Northridge, US	5
San Jose, US	4
San Luis Obispo, US	3
Arcata, US	3
EL PASO, US	2
South Kensington, GB	2
ASUlocation not on record	2
Severin-McDaniel Insect Collectionlocation not on record	2
St. Paul, US	2
Saint Louis, US	2
Long Beach, US	1
Chongqing Museumlocation not on record	1
Corvallis, US	1
Macomb, US	1
Mississippi State, US	1
Tempe, US	1
Mexico City, MX	1
Logan, US	1
San Francisco, US	1
Santa Cruz, US	1
Vancouver, CA	1
Bloomington, US	1
Pocatello, US	1

34 institutions · 213 of 353 vouchered records shown · 140 without an institution code

09Environmental DNA25 detections

Where the DNA of Collinsia tinctoria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Collinsia tinctoria

At a glance

Sources11 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 157 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions27 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 157 records