Collinsia concolor

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Collinsia

At a glance

Occurrence records1 021

Data sources11

Biological traits13

DNA specimens9

eDNA detections7

Sources11 archives

Databases and archives Collinsia concolor's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 021 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF1 021 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Collinsia concolor is a species of flowering plant in the plantain family known by the common name Chinese houses. It is native to Southern California and Baja California. It grows in the woodlands and chaparral of the coastal mountain ranges, such as the Peninsular Ranges.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.88 mg

Seed mass max0.88 mg

Seed mass min0.88 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Collinsia concolor has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHQ653137.1 ↗557 bpUSA

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACATGTTTACAAACATACTGGGGGCCGAGGCACTTGCCGAGGCCCTCTAACTAAACCCCGGCGC …

Collinsia concolor voucher E.C. Neese 21539A (JEPS) clone 1b internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK6rbcLaITS4ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Collinsia concolor carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 71×CCDB · Cave1956

CCDB · Cave1956 — Garber

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 021 records

Wild obs. + sensor610

Museum / vouchered411

Origin

Native99

Range

Area of Occupancy AOO1 644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 270≤1 km 33≤10 km 10>10 km 9

322 georeferenced · 288 without coordinates

Open the mapobservation + sensor610

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 30≤1 km 61≤10 km 66>10 km 8

165 georeferenced · 246 without coordinates

Open the institutions mapphysical evidence411

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	136
Claremont, US	111
Riverside, US	72
Santa Barbara, US	5
Austin, US	4
Severin-McDaniel Insect Collectionlocation not on record	4
CASlocation not on record	3
ASUlocation not on record	3
San Luis Obispo, US	3
Davis, US	3
Provo, US	3
Mexico City, MX	2
Ensenada, MX	2
Phoenix, US	2
La Paz, MX	2
EL PASO, US	2
Saint Louis, US	2
Long Beach, US	2
Flagstaff, US	2
Northridge, US	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Logan, US	1
Henderson, US	1
University of Stellenboschlocation not on record	1
US	1
Bronx, US	1
Calabar, NG	1
Los Angeles, US	1
Arizona State University Biocollectionslocation not on record	1
GB	1
Irvine, US	1
Bloomington, US	1
San Diego Natural History Museum, Herbariumlocation not on record	1
San Jose, US	1

34 institutions · 379 of 411 vouchered records shown · 32 without an institution code

09Environmental DNA7 detections

Where the DNA of Collinsia concolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

Yellow-Pine Forest.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 20.5–20.5

Seasonal swing summer↔winter13.7 °C

Max temp (day)28.2 °C

Min temp (night)13.7 °C

Precipitation3.80 mm/mo

Air humidity53.6 %

Moisture balance-154 mm/mo

Vapour deficit1,124 Pa

Wind speed1.60 m/s

Cloud cover16.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources11 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 021 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions27 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 021 records