Collinsia childii

Parry ex A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Collinsia

At a glance

Occurrence records441

Data sources9

Biological traits10

DNA specimens9

eDNA detections7

Sources9 archives

Databases and archives Collinsia childii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility441 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF441 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Collinsia childii is a species of flowering plant in the plantain family known by the common name Child's blue-eyed Mary. It is endemic to California, where it grows in the mountains of the Sierra Nevada and the Southern Inner and Outer California Coast Range. It grows in woodland and shady forest habitats.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Collinsia childii has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHQ653060.1 ↗556 bpUSA

ACGT

TCGAAACCTGCAAAGCAGACCCGCGAACATGTTTACAAACATACTGGGGACCGAGGCACTTGCCGAGGCCCTCTAACTAAACCCCGGCGC …

Collinsia childii voucher B.G. Baldwin & W.S. Armbruster 1201a (JEPS) clone 3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Collinsia childii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 71×CCDB · Cave1956

CCDB · Cave1956 — Garber

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type441 records

Wild obs. + sensor117

Museum / vouchered324

Origin

Native56

Range

Area of Occupancy AOO1 032 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 65≤1 km 5≤10 km 7>10 km 2

79 georeferenced · 38 without coordinates

Open the mapobservation + sensor117

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 6≤1 km 116≤10 km 63>10 km 4

189 georeferenced · 135 without coordinates

Open the institutions mapphysical evidence324

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	60
Santa Barbara, US	52
San Diego, US	49
Riverside, US	42
CASlocation not on record	9
Severin-McDaniel Insect Collectionlocation not on record	7
Davis, US	6
San Luis Obispo, US	6
US	6
ASUlocation not on record	5
WTUlocation not on record	4
San Jose, US	4
Northridge, US	4
Bronx, US	3
Phoenix, US	2
Pullman, US	2
Angwin, US	2
Canadian Department of Agriculturelocation not on record	2
Henderson, US	1
Albuquerque, US	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Long Beach, US	1
Arcata, US	1
Los Angeles, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

26 institutions · 273 of 324 vouchered records shown · 51 without an institution code

09Environmental DNA7 detections

Where the DNA of Collinsia childii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

Oak-pine woodland (Q. kelloggii & P. coulter…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 16.8–16.8

Seasonal swing summer↔winter18.1 °C

Max temp (day)25.2 °C

Min temp (night)9.00 °C

Precipitation8.30 mm/mo

Air humidity42.5 %

Moisture balance-197 mm/mo

Vapour deficit1,112 Pa

Wind speed7.20 m/s

Cloud cover30.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)