Coleus amboinicus

Lour. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Coleus

At a glance

Occurrence records1 150

Data sources14

Biological traits33

DNA specimens8

eDNA detections6

Sources14 archives

Databases and archives Coleus amboinicus's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 150 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS61 compounds

Occurrence & distributionGBIF1 150 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Coleus amboinicus, synonym Plectranthus amboinicus, is a semi-succulent perennial plant in the family Lamiaceae with a pungent oregano-like flavor and odor. Coleus amboinicus is considered to be native to parts of Africa, the Arabian Peninsula, and India, although it is widely cultivated and naturalized elsewhere in the tropics where it is used as a spice and ornamental plant. Common names in English include Indian borage, country borage, French thyme, Indian mint, Mexican mint, Cuban oregano, soup mint, Spanish thyme. The species epithet, amboinicus refers to Ambon Island, in Indonesia, where it was apparently encountered and described by João de Loureiro (1717–1791).https://www.smgrowers.com/products/plants/plantdisplay.asp?cat_id=14&plant_id=3810&page=9, accessed 23 May 2020

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology12

Leaf length50 mm

Leaf length max70 mm

Leaf length min30 mm

Leaf width42.5 mm

Leaf width max60 mm

Leaf width min25 mm

Petiole length0.7 cm

Plant height1 m

⚠ sources differ — GIFT: 1 m · AusTraits: 1.5 m

Plant height max1.5 m

Seed mass0.141 mg

Seed mass max0.17 mg

Seed mass min0.11 mg

Life cycle & reproduction7

Deciduousnessevergreen

Dispersal type detailedanthropochorous

Flowering timennnnnnnnyyyn

Life formscrambling subshrub

Life spanperennial

Raunkiær life formchamaephyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 700 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Leaf compoundnesssimple

Leaf shapetriangular widely_ovate

Succulenceno

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition61 compounds

Compounds documented for Coleus amboinicus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking💊 Medicinal use documented

Compound class profile5 classes

Cinnamic acids and derivatives6

Neolignans6

Menthane monoterpenoids5

Abietane diterpenoids5

Oleanane triterpenoids4

Documented compounds61 total

Tissue Source Quantified only

Compound	Amount	Source
WATER	944,000 ppm	DukesPhytochem
CARBOHYDRATES	553,570 ppm	DukesPhytochem
CARVACROL	430,000 ppm	DukesPhytochem
ASH	214,285 ppm	DukesPhytochem
PROTEIN	160,715 ppm	DukesPhytochem
FIBER	89,285 ppm	DukesPhytochem
FAT	71,430 ppm	DukesPhytochem
CALCIUM	41,430 ppm	DukesPhytochem
KILOCALORIES	3,035 ppm	DukesPhytochem
ASCORBIC-ACID	2,145 ppm	DukesPhytochem

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coleus amboinicus has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes4

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLOR241091.1 ↗1 138 bp

ACGT

CCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAAT …

Coleus amboinicus isolate P74L ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL8★rbcLa★ITS

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Coleus amboinicus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome records26–682n range34median34mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 322×CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Scheel, M. 1931 ; Reddy, N.S. 1952 ; Morton, J.K. 1962

CCDB · book-atlas-flowering-plants — Scheel 1931

2n 342×CCDB · ipcn-api-dl · CCDB · book-indian_vol1

CCDB · ipcn-api-dl — Hsieh, T. h. & T. c. Huang. 1998. Notes on the Flora of Taiwan (32)---Miscellaneous notes on Lamiaceae of Taiwan. Taiwania 43(1): 38–58.

CCDB · book-indian_vol1 — Ramachandran, K. 1967

2n 261×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Vembu, B. 1984. On the chromosome numbers of some members of Lamiaceae. Proc. Indian Sci. Congr. Assoc. 71(3–VI): 80–81.

2n 561×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Krishnappa, D. G. & I. Basavaraj. 1982. In IOPB chromosome number reports LXXV. Taxon 31: 361–362.

2n 681×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Mehra, P.N. & Gill, L.S. 1968b, 1972

n 343×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Gill, L. S. 1984. The incidence of polyploidy in the West-Himalayan Labiatae. Rev. Cytol. Biol. Vég., Bot. 7: 5–16.

CCDB · book-ipcn72 — MEHRA, P.N., & L.S. GILL. 1972. Cytology of west Himalayan Labiatae: Tribe Ocimoideae. Cytologia 37: 53-57.

CCDB · book-ipcn67-71 — MEHRA, P.N., & L.S. GILL. 1968. In IOPB chromosome number reports XVIII. Taxon 17: 419-422.

n 171×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Bir, S. S. & M. I. S. Saggoo. 1985. Cytological studies on members of family Labiatae from Kodaikanal and adjoining areas (South India). Proc. Indian Acad. Sci. 94: 619–626.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.936 ↗

08Occurrence & distribution

Record type1 150 records

Wild obs. + sensor920

Museum / vouchered226

Other4

Origin

Native2

Introduced19

Range

Area of Occupancy AOO3 568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 564≤1 km 86≤10 km 75>10 km 58

783 georeferenced · 137 without coordinates

Open the mapobservation + sensor920

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 36≤1 km 7≤10 km 19>10 km 4

66 georeferenced · 160 without coordinates

Open the institutions mapphysical evidence226

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	20
UEPAlocation not on record	17
Durban, ZA	8
Mount Annan, AU	7
Laboratorio de Ictiologialocation not on record	7
Mérida, MX	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record	4
Bronx, US	4
SLU Artdatabankenlocation not on record	3
Universidad de Antioquia (UdeA)location not on record	3
Canberra, AU	3
JBRJlocation not on record	3
Auckland, NZ	2
LDlocation not on record	2
Philadelphia, US	2
MeiseBGlocation not on record	2
University of Stellenboschlocation not on record	2
Baroda, IN	2
Tampa, US	2
Universidad de Nariño (UdeNar)location not on record	2
UFPIlocation not on record	2
Phoenix, US	1
Davis, US	1
Adam Mickiewicz University in Poznańlocation not on record	1
Universidad Nacional de Colombia (UNAL)location not on record	1
Université de Strasbourglocation not on record	1
Giardini Botanici Hanburylocation not on record	1
Kew, GB	1
UFOPlocation not on record	1
Smithfield, AU	1
Ilhéus, BR	1
UFRPElocation not on record	1
Pontificia Universidad Javeriana (PUJ)location not on record	1
Vietnam Academy of Science and Technology (VAST)location not on record	1
HACAMlocation not on record	1
Uppsala, SE	1
Guangzhou, CN	1
Alexandria Universitylocation not on record	1
Wlocation not on record	1
IPA/SPlocation not on record	1
Plocation not on record	1
Guasave, MX	1
Saint Louis, US	1

44 institutions · 129 of 226 vouchered records shown · 96 without an institution code

09Environmental DNA6 detections

Where the DNA of Coleus amboinicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 18.9–24.4

Seasonal swing summer↔winter14.1 °C

Max temp (day)25.9 °C 22.3–29.5

Min temp (night)17.1 °C 15.4–18.9

Precipitation55.9 mm/mo 13.7–98.2

Air humidity55.9 % 52.7–59.1

Moisture balance-80.5 mm/mo -131–-30.3

Vapour deficit1,228 Pa 917–1,538

Wind speed3.20 m/s 2.10–4.40

Cloud cover28.3 % 25.8–30.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Coleus amboinicus

At a glance

Sources14 archives

Size & morphology12

Life cycle & reproduction7

Diet & foraging1

Habitat & environment11

Physiology & chemistry1

Other traits1

Compound class profile5 classes

Documented compounds61 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 150 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 44 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 150 records