Coleophora granulatella

Zeller, 1849 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Coleophoridae/Coleophora

At a glance

Occurrence records327

Data sources7

Biological traits0

DNA specimens89

eDNA detections110

Sources7 archives

Databases and archives Coleophora granulatella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility327 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI110 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics89 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF327 records

Environmental DNA1 datasets · 14 countries110 detections

DNA & barcodingBOLD89 specimens

01Narrative

Coleophora granulatella is a moth of the family Coleophoridae. It is known from most of Europe to China. It was recently reported from North America, with records from Alberta, British Columbia, Yukon, Arizona, Colorado, Michigan, Wyoming and Washington.Shared but overlooked: 30 species of Holarctic Microlepidoptera revealed by DNA barcodes and morphology The wingspan is 11–13 mm. The larvae feed on Artemisia campestris. They mine the leaves of their host plant.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding89 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coleophora granulatella has left across the world's sequence archives.

At a glance

DNA specimens89

BINs2

Marker genes3

eDNA detections110

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus84 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

100Amostly conserved

145Cmostly conserved

316Tmostly conserved

317Amostly conserved

379Cvariable

448Cvariable

529Tmostly conserved

538Tmostly conserved

562Amostly conserved

601Cmostly conserved

646Tmostly conserved

AACATTATATTTCATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.61%

Haplotypes20

BINs2

Most divergent pair1.7%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Coleophora fasciellasame genus1.7%Coleophora tridentiferasame genus2.1%Coleophora artemisicolellasame genus2.3%Coleophora nubivagellasame genus2.7%Coleophora scabridasame genus3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5PCYTB

animal barcodemitochondrial

08Occurrence & distribution

Record type327 records

Wild obs. + sensor198

Museum / vouchered127

Other2

Range

Area of Occupancy AOO580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 59≤1 km 59≤10 km 57>10 km 19

194 georeferenced · 4 without coordinates

Open the mapobservation + sensor198

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 8≤1 km 47≤10 km 3

58 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence127

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	23
SLU Artdatabankenlocation not on record	16
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	14
NHMOlocation not on record	10
Provincia di Livornolocation not on record	7
Rovaniemi, FI	1
Kuopio, FI	1
Metsähallituslocation not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
DanishLepidopterologicalSocietylocation not on record	1
Museum Zoological Helsinkilocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
neflocation not on record	1

13 institutions · 78 of 127 vouchered records shown · 49 without an institution code

09Environmental DNA110 detections

Where the DNA of Coleophora granulatella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found110

Studies independent surveys1

Countries14

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 110 detections have coordinates

Open the map14 countries0

161.4. Temperate Forest | 1. Forest & Woodland4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 8.60–21.5

Seasonal swing summer↔winter26.1 °C

Max temp (day)23.3 °C 12.0–25.3

Min temp (night)12.9 °C 3.90–19.2

Precipitation75.7 mm/mo 29.8–90.4

Air humidity58.6 % 51.2–61.7

Moisture balance-73.1 mm/mo -114–-35.0

Vapour deficit912 Pa 426–1,093

Wind speed3.30 m/s 2.20–4.40

Cloud cover36.1 % 20.3–45.7

CHELSA 1981–2010, ~9 km grid, at location & month of 88 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)