Coleonema pulchellum

I.Williams · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Coleonema

At a glance

Occurrence records460

Data sources9

Biological traits26

DNA specimens3

eDNA detections2

Sources9 archives

Databases and archives Coleonema pulchellum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility460 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Chemical compositionLOTUS · NPASS50 compounds

Occurrence & distributionGBIF460 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Coleonema pulchellum, commonly known as confetti bush, buchu, diosma or breath of heaven, is a shrub which is endemic to South Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology10

Leaf length10 mm

Leaf width1 mm

Petiole length0.1 cm

Plant height1.75 m

Plant height max1.5 m

Plant height min0.69 m

Seed length3 mm

Seed mass1.8 mg

Seed mass max1.8 mg

Seed mass min1.8 mg

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max200 m

Elevation min0 m

Epiphyteterrestrial

Fruit typeschizocarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition50 compounds

Compounds documented for Coleonema pulchellum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids9

Cinnamic acids and derivatives8

Isoquinoline alkaloids3

N-acyl amines2

Pimarane and Isopimarane diterpenoids2

Documented compounds50 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Argemonine	present	NPASS
(-)-Thalrugosinone	present	NPASS
(1R,4aR,6S,8aS,10aR)-6-ethenyl-1,4a,6-trimethyl-3,4,7,8,8a,9,10,10a-octahydro-2H-phenanthrene-1-carboxylic acid	present	LOTUS
(4aR,16aS)-3,4,4a,5,16a,17,18,19-Octahydro-9,21,26-trimethoxy-4,17-dimethyl-2H-1,24:12,15-dietheno-6,10-metheno-16H-pyrido(2',3':17,18)(1,10)dioxacycloeicosino(2,3,4-ij)isoquinolin-22-ol	present	NPASS
(4aS,16aR)-3,4,4a,5,16a,17,18,19-Octahydro-21,26-dimethoxy-4,17-dimethyl-16H-1,24:6,9-dietheno-11,15-metheno-2H-pyrido(2',3':17,18)(1,11)dioxacycloeicosino(2,3,4-ij)isoquinoline-12,22-diol	present	NPASS
(E)-3-(2,2-dimethylchromen-6-yl)prop-2-en-1-ol	present	LOTUS
(E)-3-[4-[(2E)-3,7-dimethylocta-2,6-dienoxy]phenyl]prop-2-en-1-ol	present	LOTUS
(E)-3-[4-[(2E)-3,7-dimethylocta-2,6-dienoxy]phenyl]prop-2-enal	present	LOTUS
(R,S)-homoaromaline hydrochloride	present	NPASS
3-(2,2-Dimethylchromen-6-yl)prop-2-en-1-ol	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coleonema pulchellum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW824636.1 ↗600 bp

ACGT

CCAGCAGAACGACCCGCGAACTCGTGAATACACAAGGGGGCGCGCTCGCTACGAGCGTCGCTCTCCCCTCGTCGCGGGTGCGGGACTTGT …

Coleonema pulchellum voucher Nowell 170 (BOL) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type460 records

Wild obs. + sensor323

Museum / vouchered137

Origin

Native1

Introduced97

Range

Area of Occupancy AOO1 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 197≤1 km 49≤10 km 11>10 km 4

261 georeferenced · 62 without coordinates

Open the mapobservation + sensor323

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 27≤1 km 35≤10 km 21

83 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	35
Adelaide, AU	28
Museo Entomologico de Leonlocation not on record	14
Kensington, AU	8
Canberra, AU	8
Hobart, AU	6
John T. Waterhouse Herbariumlocation not on record	6
Christchurch, NZ	5
Mount Annan, AU	4
Cape Town, ZA	3
Turlock, US	2
Northridge, US	2
Rotorua, NZ	2
Armidale, AU	2
EL PASO, US	1
Wellington, NZ	1
Brisbane, AU	1
University of Cape Town, Bolus Herbariumlocation not on record	1
Parkville, AU	1
Long Beach, US	1
Auckland, NZ	1
Moscow, US	1
València, ES	1

23 institutions · 134 of 137 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Coleonema pulchellum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 17.8–17.8

Seasonal swing summer↔winter7.30 °C

Max temp (day)22.0 °C

Min temp (night)13.8 °C

Precipitation56.8 mm/mo

Air humidity59.4 %

Moisture balance-78.0 mm/mo

Vapour deficit823 Pa

Wind speed4.00 m/s

Cloud cover21.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)