Colebrookea oppositifolia

Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Colebrookea

At a glance

Occurrence records423

Data sources11

Biological traits16

DNA specimens5

eDNA detections5

Sources11 archives

Databases and archives Colebrookea oppositifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility423 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS · NPASS14 compounds

Occurrence & distributionGBIF423 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Colebrookea oppositifolia là một loài thực vật có hoa trong họ Hoa môi. Loài này được Sm. mô tả khoa học đầu tiên năm 1806.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction5

Flowering endOct

Flowering startApr

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 300 m

Elevation min200 m

Epiphyteterrestrial

Growth formshrub

Mycorrhiza type0.000000025

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition14 compounds

Compounds documented for Colebrookea oppositifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Kaurane and Phyllocladane diterpenoids8

Flavones5

Kaurane and Phyllocladane diterpenoids $ Tetracyclic diterpenoids1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,4R,5S,8S,9R,10S,13S,16R)-2,8,16-trihydroxy-5,9-bis(hydroxymethyl)-5-methyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecan-15-one	present	NPASS
(1R,2R,4R,5S,8S,9R,10S,13S,16R)-2,8,16-trihydroxy-5-(hydroxymethyl)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecan-15-one	present	NPASS
(1R,2R,4S,5S,8S,9R,10S,13S,16R)-2,8,16-trihydroxy-5,9-dimethyl-14-methylidene-15-oxotetracyclo[11.2.1.01,10.04,9]hexadecane-5-carbaldehyde	present	NPASS
(1R,2R,4S,5S,9S,10S,13S,16R)-2,16-dihydroxy-9-(hydroxymethyl)-5-methyl-14-methylidene-15-oxotetracyclo[11.2.1.01,10.04,9]hexadecane-5-carbaldehyde	present	NPASS
(1S,2S,5S,8S,9R,11R,15S,16R,18R)-15,18-dihydroxy-16-methoxy-12,12-dimethyl-6-methylidene-17-oxapentacyclo[7.6.2.15,8.01,11.02,8]octadecan-7-one	present	NPASS
2-[(1R,2R,4R,5R,9S,10S,13S,16R)-2,16-dihydroxy-9-(hydroxymethyl)-5-methyl-14-methylidene-15-oxo-5-tetracyclo[11.2.1.01,10.04,9]hexadecanyl]acetaldehyde	present	NPASS
4H-1-benzopyran-4-one, 6-(beta-D-glucopyranosyloxy)-5-hydroxy-7-methoxy-2-phenyl	present	LOTUS
5,7-dihydroxy-2-[2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]chromen-4-one	present	LOTUS
[(1R,2R,4R,5S,8S,9R,10S,13S,16R)-2,8,16-trihydroxy-5,9-dimethyl-14-methylidene-15-oxo-5-tetracyclo[11.2.1.01,10.04,9]hexadecanyl]methyl acetate	present	NPASS
Chrysin	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Colebrookea oppositifolia has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPX452925.1 ↗279 bpIndia · 2024

ACGT

CGTCGCCCCCCCACGCACACAGCGCTTGGTGTGGGGCGGAGATTGGCCTCCCGTGCGCTCCGTCGTGCGGCCGGCCCAAATGCGATCCCC …

Colebrookea oppositifolia voucher PKCOBS02 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Colebrookea oppositifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Chromosome records32–322n range32median32mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 325×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · book-fedorov

CCDB · ipcn-api-dl — Cherian, M. & P. I. Kuriachan. 1993. Cytotaxonomic studies of the subtribe Pogostemoninae sensu Bentham (Labiatae) from south India. Cytologia 58: 439–444.

CCDB · book-indian_vol1 — Gajapathy, C. 1961

CCDB · book-indian_vol1 — Gill, L.S. 1971a

CCDB · book-fedorov — Gajapathy 1961

CCDB · book-fedorov — I. 1964)

n 161×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Cherian, M. & P. I. Kuriachan. 1993. Cytotaxonomic studies of the subtribe Pogostemoninae sensu Bentham (Labiatae) from south India. Cytologia 58: 439–444.

n 171×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Koul et al. 1976b

08Occurrence & distribution

Record type423 records

Wild obs. + sensor201

Museum / vouchered212

Other10

Range

Area of Occupancy AOO1 108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 58≤1 km 31≤10 km 34>10 km 4

127 georeferenced · 74 without coordinates

Open the mapobservation + sensor201

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 2≤1 km 46≤10 km 13>10 km 15

76 georeferenced · 136 without coordinates

Open the institutions mapphysical evidence212

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	33
Baroda, IN	29
Natural History Museum, Tribhuvan Universitylocation not on record	19
Guangzhou, CN	14
QAUlocation not on record	14
Hazara Universitylocation not on record	10
Nanjing, CN	10
Dehra Dun, IN	8
Pondicherry, IN	6
Yunnan Universitylocation not on record	6
Cambridge, US	6
云南省思茅市民族传统医药研究所location not on record	5
Yangling, CN	5
Herbarium of the Department of Botany, University of Tokyolocation not on record	4
University of Stellenboschlocation not on record	3
Moscow State Universitylocation not on record	3
Fort Worth, US	2
Southwest Forestry Collegelocation not on record	2
Wuhan, CN	2
Kagoshima, JP	2
Jinghong, CN	2
Qarshi Botanical Gardenlocation not on record	1
Edinburgh, GB	1
Chengdu, CN	1
South Kensington, GB	1
Kew, GB	1
Ann Arbor, US	1
Kunming, CN	1
Bronx, US	1
Guilin, CN	1
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	1
Davis, US	1

32 institutions · 196 of 212 vouchered records shown · 16 without an institution code

09Environmental DNA5 detections

Where the DNA of Colebrookea oppositifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)