Coleanthus subtilis

(Tratt.) Seidel ex Roem. & Schult. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Coleanthus

At a glance

Occurrence records1 090

Data sources12

Biological traits26

DNA specimens9

eDNA detections5

Sources12 archives

Databases and archives Coleanthus subtilis's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 090 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF1 090 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Coleanthus is a genus of Eurasian and North American plants in the grass family. The only known species is Coleanthus subtilis. It has a scattered distribution, found on lakeshores, streambanks, and other wet places in central Europe (France, Germany, Czech Rep; extinct in Norway + Italy), Asia (Western Siberia, Khabarovsk, eastern China), and northwestern North America (Oregon, Washington, British Columbia).Kew World Checklist of Selected Plant FamiliesFlora of China Vol. 22 Page 340 莎禾 suo he Coleanthus subtilis (Trattinnick) Seidel in Roemer & Schultes, Syst. Veg. 2: 276. 1817.Grassbase - The World Online Grass FloraKharkevich, S.S., Probatova, N.S. & Novikov, V.S. (1985). Sosudistye rasteniia sovetskogo Dal’nego Vostoka 1: 1-383. Izd-vo "Nauka," Leningradskoe otd-nie, LeningradMalyschev, L.I. & Peschkova, G.A. (eds.) (2001). Flora of Siberia 2: 1-362. Scientific Publishers, Inc., Enfield, PlymouthBiota of North America Program 2013 county distribution map

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology5

Plant height0.03 m

⚠ sources differ — GIFT: 0.03 m · LEDA: 0.03 m · TRY: 0.055 m

Plant height generative0.045 m

Plant height max0.07 m

Plant height min0.02 m

Seed mass0.046 mg

⚠ sources differ — TRY: 0.046 mg · LEDA: 0.027 mg · GIFT: 0.036 mg

Life cycle & reproduction11

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dispersal typeanimal

Flowering endOct

Flowering startJul

Life formannual

Life spanannual

Lifespan years1 years

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formtherophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTlakes, rivers, swamps

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Diaspore typeone-seeded generative dispersule

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coleanthus subtilis has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMN545342.1 ↗339 bpRussia · 2014

ACGT

AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAATA …

Coleanthus subtilis isolate 17-G27(3) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Coleanthus subtilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidypolyploid inferred

Chromosome records14–142n range14median14mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 144×CCDB · book-ipcn67-71 · CCDB · eflora · CCDB · book-fedorov +1

CCDB · book-ipcn67-71 — HEJNY, s. 1969. Coleanthus subtilis (Tratt. l Seidl in der Tschechoslowakei. Folia Geob. Phyto. (Czech.) 4: 345-399.

CCDB · eflora

CCDB · book-fedorov — Litardiere 1950

CCDB · book-atlas-flowering-plants — Litardiere 1950

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 090 records

Wild obs. + sensor963

Museum / vouchered127

Range

Area of Occupancy AOO1 388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 272≤1 km 191≤10 km 367>10 km 47

877 georeferenced · 86 without coordinates

Open the mapobservation + sensor963

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤1 km 2≤10 km 51>10 km 20

73 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence127

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oskarshamn, SE	9
Pullman, US	8
Vancouver, CA	7
Adam Mickiewicz University in Poznańlocation not on record	7
Moscow State Universitylocation not on record	6
LDlocation not on record	3
University of British Columbia, Herbariumlocation not on record	3
Karlsruhe, DE	3
Beijing, CN	2
Salzburg, AT	2
WTUlocation not on record	2
Provincia di Livornolocation not on record	1
Görlitz, DE	1
Tampa, US	1
Canadian Department of Agriculturelocation not on record	1
Davenport, US	1
Bourges, FR	1
Universität Göttingenlocation not on record	1

18 institutions · 59 of 127 vouchered records shown · 68 without an institution code

09Environmental DNA5 detections

Where the DNA of Coleanthus subtilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

On mudflats with shallow water on surfaceLow muddy bottom-landsMudflat cattle pasture, with Gnaphalium ulig…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 10.1–15.5

Seasonal swing summer↔winter23.2 °C

Max temp (day)15.2 °C 13.9–20.4

Min temp (night)7.40 °C 6.50–11.4

Precipitation43.0 mm/mo 36.8–159

Air humidity61.2 % 57.5–62.6

Moisture balance9.00 mm/mo -28.0–114

Vapour deficit478 Pa 478–760

Wind speed1.20 m/s 1.10–2.10

Cloud cover45.3 % 42.3–45.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Coleanthus subtilis

At a glance

Sources12 archives

Size & morphology5

Life cycle & reproduction11

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 090 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 090 records