Colchicum variegatum

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Colchicaceae/Colchicum

At a glance

Occurrence records624

Data sources9

Biological traits11

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Colchicum variegatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility624 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF624 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 44

01Narrative

اللحلاح المبرقش أو سورنجان مُزَيّن نوع نباتي يتبع جنس اللحلاح من الفصيلة اللحلاحية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Colchicum variegatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Phenethylisoquinoline alkaloids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
N-(5,6,7,9-Tetrahydro-1,2,3,10-tetramethoxy-9-oxobenzo(a)heptalen-7-yl)acetamide		present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Colchicum variegatum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF596478.1 ↗201 bpTurkey · 2009

ACGT

CGCGCACGACCAGTGAACGGAACGCCCCCTCCTCCCGGGCCGCCTCGGCAGCACGGGCGGGGGGAAACGGACGAAACCCCGGCGCGACCC …

Colchicum variegatum voucher C1502B internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS8

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Colchicum variegatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome records44–542n range44median44mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 444×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1

CCDB · iapt — IAPT/IOPB Chromosome Data 7

CCDB · ipcn-api-dl — Sik, L. & O. Küçüker. 1998. Mediterranean chromosome number reports 8 (997--1000). Fl. Medit. 8: 296–298.

CCDB · book-ipcn75-78 — Nakamura 1978

CCDB · book-atlas-flowering-plants

2n 541×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 7

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type624 records

Wild obs. + sensor589

Museum / vouchered29

Cultivated / captive6

Origin

Native4

Range

Area of Occupancy AOO1 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 311≤1 km 35≤10 km 28>10 km 8

382 georeferenced · 207 without coordinates

Open the mapobservation + sensor589

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence29

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	21
Berlin, DE	3
Wlocation not on record	2
Edinburgh, GB	1
BGBMlocation not on record	1

5 institutions · 28 of 29 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)