Colchicum stevenii

Kunth · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Colchicaceae/Colchicum

At a glance

Occurrence records2 967

Data sources7

Biological traits11

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Colchicum stevenii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 967 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF2 967 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 54

01Narrative

Colchicum stevenii, or Steven's meadow saffron, is a species of flowering plant in the family Colchicaceae. Arabic: سَراجُ الغولة, سُورَنْجان Hebrew: סתוונית היורה

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass3.27 mg

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Colchicum stevenii has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF596451.1 ↗201 bpTurkey · 2009

ACGT

CCCGCGAACCCAGTGAACGGAACGCCCCCTCCTCCCGGGCCGCCCCGGCGGCGCGGGCGGGGGGAAACGGACGAAACCCCGGCGCGACCC …

Colchicum stevenii voucher C0733 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Colchicum stevenii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidypolyploid inferred

Chromosome records54–542n range54median54mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 544×CCDB · iapt · CCDB · colchicaceae · CCDB · book-atlas-flowering-plants +1

CCDB · iapt — IAPT/IOPB Chromosome Data 7

CCDB · colchicaceae — Feinbrun 1958

CCDB · book-atlas-flowering-plants

CCDB · Cave1958 — Feinbrun 1958a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 967 records

Wild obs. + sensor2 956

Museum / vouchered11

Range

Area of Occupancy AOO3 088 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 381≤1 km 123≤10 km 118>10 km 11

633 georeferenced · 2 323 without coordinates

Open the mapobservation + sensor2 956

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Rishon Le Zion, IL	9
Paris, FR	2

2 institutions · 11 of 11 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Colchicum stevenii

At a glance

Sources7 archives

Size & morphology1

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 967 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 2 geolocated

Record type2 967 records