Colchicum davisii — The Life Data

Plantae/Tracheophyta/Liliopsida/Liliales/Colchicaceae/Colchicum

At a glance

Occurrence records0

Data sources6

Biological traits9

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Colchicum davisii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 46

01Narrative

Colchicum davisii is a large-flowering plant species native to Turkey.Kew World Checklist of Selected Plant Families, Colchicum davisii The flowers are very pale pink and heavily tessellated with a white throat and prominent yellow anthers. They are produced in autumn. The corms, are elongated and have several growing points.Christopher David Brickell. 1998. New Plantsman 5(1): 15, Colchicum davisiiAutumn Bulbs by Roy Leeds (B.T. Batsford Ltd) 2006

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding9 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Colchicum davisii has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences9

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF596376.1 ↗202 bpTurkey · 2009

ACGT

ACCCGCGCCGACCGTGAACGGAACGCCCCCCCCTCCCGCGCCGCCCCGGCGGCGCGGGCGGGGGGAAACGGACGAAACCCCGGCGCGACC …

Colchicum davisii voucher C2703 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK3rbcL3ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Colchicum davisii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 46 n = 23

Ploidypolyploid inferred

Chromosome records46–462n range46median46mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 462×CCDB · ipcn-api-dl · CCDB · colchicaceae

CCDB · ipcn-api-dl — Persson, K. 1999. The genus Colchicum in Turkey. II. Revision of the large-leaved autumnal species. Edinburgh J. Bot. 56: 103–142.

CCDB · colchicaceae — Persson 1999

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗