Colchicum cilicicum

(Boiss.) Dammer · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Colchicaceae/Colchicum

At a glance

Occurrence records31

Data sources8

Biological traits9

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Colchicum cilicicum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF31 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 54

01Narrative

Le colchique de Cilicie, Colchicum cilicicum, est une espèce de plantes à fleurs de la famille des Colchicacées trouvée en Turquie et en Syrie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Colchicum cilicicum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Phenethylisoquinoline alkaloids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
N-(5,6,7,9-Tetrahydro-1,2,3,10-tetramethoxy-9-oxobenzo(a)heptalen-7-yl)acetamide		present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Colchicum cilicicum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF596366.1 ↗203 bpTurkey · 2009

ACGT

GACCCGCGACTCCAGTGAACGGAACGCCCCCTCCTCCCGTGCCGCCCCGGCGGCCCGGGCGGGGGGAAACGGATGAAAACCCGGCGCGAC …

Colchicum cilicicum voucher C3105 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS8

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Colchicum cilicicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidypolyploid inferred

Chromosome records54–542n range54median54mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 542×CCDB · ipcn-api-dl · CCDB · colchicaceae

CCDB · ipcn-api-dl — Persson, K. 1999. The genus Colchicum in Turkey. II. Revision of the large-leaved autumnal species. Edinburgh J. Bot. 56: 103–142.

CCDB · colchicaceae — Persson 1999

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type31 records

Wild obs. + sensor24

Museum / vouchered6

Cultivated / captive1

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 23≤1 km 1

24 georeferenced

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence6

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
LDlocation not on record	4
SLU Artdatabankenlocation not on record	2

2 institutions · 6 of 6 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)