Colchicum bulbocodium

Ker Gawl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Colchicaceae/Colchicum

At a glance

Occurrence records3 867

Data sources10

Biological traits18

DNA specimens6

eDNA detections15

Sources10 archives

Databases and archives Colchicum bulbocodium's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 867 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS · NPASS18 compounds

Occurrence & distributionGBIF3 867 records

Environmental DNA1 datasets · 6 countries15 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 22

01Narrative

La Campanette ou Bulbocode de printemps, est une espèce de plantes à fleurs de la famille des Colchicaceae. C'est un colchique miniature à tépales libres, qui fleurit à la fin de l’hiver et au début du printemps.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height0.1 m

Plant height max0.2 m

Plant height min0.05 m

Life cycle & reproduction5

Flowering endApr

Flowering startFeb

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTmeadows: wet, mountains, shrubberies, steppe

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)185 mg/g

Specific leaf area (SLA)30.39 mm²/mg

Other traits1

Plant support typefree-standing

03Chemical composition18 compounds

Compounds documented for Colchicum bulbocodium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Phenethylisoquinoline alkaloids4

Trichothecane sesquiterpenoids3

Isoquinoline alkaloids1

Flavones1

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
4-(6-Hydroxy-5-methoxy-1-methyl-2,3,7,8,9,9a-hexahydrobenzo[de]quinolin-7-yl)cyclohex-2-en-1-one	present	LOTUS
Anguidine deriv scirpentriol	present	NPASS
Colchicine	present	LOTUS
Deoxynivalenol	present	NPASS
IRXDUBNENLKYTC-ZAXVWJELSA-N	present	NPASS
JSKXQQKSUOVSKS-UJGURONMSA-N	present	NPASS
KUXHMHSAZYHINP-QRMUCJMYSA-N	present	NPASS
Luteolin 7-diglucoside	present	LOTUS
MZNCWPOVMBLUSG-VOUIFILWSA-N	present	NPASS
N-(1,2,3,10-tetramethoxy-9-oxo-6,7-dihydro-5H-benzo[a]heptalen-7-yl)formamide	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Colchicum bulbocodium has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences10

eDNA detections15

Countries6

The DNA barcodea real sequence read deposited for this species

ITSOQ784150.1 ↗213 bpRussia

ACGT

TCGAGACCGAACGGAAGACCCGCGAACCCGTGAACGGATGCCCCCTCCTCCCGAGCCGCCCCGACGGCGCGGGCGGGGGGAACGGACGAA …

Colchicum bulbocodium subsp. versicolor strain sml_2(pseudo) internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL6★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Colchicum bulbocodium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidypolyploid inferred

Chromosome records22–1082n range22median22mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 225×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · colchicaceae +1

CCDB · iapt — IAPT/IOPB Chromosome Data 7

CCDB · ipcn-api-dl — Wetschnig, W. 1992. Chromosomenzahlen Kärntner Gefässpflanzen (Teil 4): Karyotypmorphologie von Bulbocodium vernum L. (Colchicaceae). Carinthia II 182: 535–544.

CCDB · colchicaceae — Wetschnig 1992

CCDB · book-atlas-flowering-plants — Levan & S. 1947

2n 1082×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 7

2n 481×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 7

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 867 records

Wild obs. + sensor3 613

Museum / vouchered36

Cultivated / captive4

Other214

Range

Area of Occupancy AOO3 264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 1 292≤1 km 152≤10 km 1 561>10 km 129

3 134 georeferenced · 479 without coordinates

Open the mapobservation + sensor3 613

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 1≤1 km 5≤10 km 5

11 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence36

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BDBClocation not on record	15
Porrentruy, CH	4
Sion, CH	2
Auckland, NZ	2
GZUlocation not on record	2
Dresden, DE	1
CJBGlocation not on record	1
MeiseBGlocation not on record	1
Frankfurt am Main	1

9 institutions · 29 of 36 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA15 detections

Where the DNA of Colchicum bulbocodium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 8.80–11.8

Seasonal swing summer↔winter22.3 °C

Max temp (day)15.3 °C 12.8–16.2

Min temp (night)6.70 °C 4.80–7.20

Precipitation47.9 mm/mo 47.9–75.6

Air humidity59.3 % 58.8–62.3

Moisture balance-24.0 mm/mo -30.0–-9.60

Vapour deficit629 Pa 545–658

Wind speed2.70 m/s 2.70–4.20

Cloud cover45.5 % 42.0–45.5

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Colchicum bulbocodium

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction5

Diet & foraging1

Habitat & environment6

Physiology & chemistry2

Other traits1

Compound class profile4 classes

Documented compounds18 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 867 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions5 of 9 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 867 records