Cola nitida

(Vent.) Schott & Endl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Cola

At a glance

Occurrence records627

Data sources15

Biological traits15

DNA specimens3

eDNA detections2

Sources15 archives

Databases and archives Cola nitida's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility627 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

foodatlascompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionFoodAtlas · LOTUS · NPASS10 compounds

Occurrence & distributionGBIF627 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2.4 Gbp

01Narrative

Cola nitida is a species of plant belonging to the family Malvaceae. It is a tree native to the rainforests of tropical West Africa. Common names include kola nut, cola, kola and bitter kola. The seeds contain caffeine and are chewed as a stimulant and used in the manufacture of soft drinks. The nuts and other parts of the tree have many uses of a ceremonial nature and in traditional medicine. The timber has multiple uses.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height20 m

Plant height max24.38 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition10 compounds

Compounds documented for Cola nitida across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile3 classes

Proanthocyanins4

Flavan-3-ols4

Purine alkaloids3

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
alpha-Catechin	present	LOTUS
Caffeine	present	LOTUS
Catechin	present	LOTUS
methylxanthine	present	FoodAtlas
Procyanidin B1	present	LOTUS
Procyanidin B2	present	LOTUS
Theobromine	present	LOTUS
THEOPHYLLINE	present	FoodAtlas

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cola nitida has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMK090247.1 ↗554 bp

ACGT

TAAATCTGCTTTGCCGTNGGTTCTTGGCGGGATAAACCCCAATTTTAGGTTTAATAGTACATTCTAATAGGGGGCGACCGTACTTGTTCA …

UNVERIFIED: Cola nitida bio-material AHP_Lot_2184 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit-like (rbcL) gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Cola nitida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 376 540 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Cola nitida2.38 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–402n range40median40mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 403×CCDB · book-ipcn67-71 · CCDB · book-indian_vol1

CCDB · book-ipcn67-71 — POTY, J., & J.-L. HAMEL. 1968. Contribution a l'etude caryo- taxinomique des Sterculiacees. Mem. Mus. National Hist. Naturelle Ser. B. 18: 3-36.

CCDB · book-indian_vol1 — Mangenot, S. & Mangenot, G. 1962

CCDB · book-indian_vol1 — Poty, J. & Hamel, J.-L. 1968

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type627 records

Wild obs. + sensor291

Museum / vouchered325

Other11

Origin

Introduced10

Range

Area of Occupancy AOO1 184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 17≤1 km 10≤10 km 1>10 km 12

40 georeferenced · 251 without coordinates

Open the mapobservation + sensor291

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 324 without coordinates

Open the institutions mapphysical evidence325

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Yaoundé, CM	48
MeiseBGlocation not on record	22
Saint Louis, US	22
HNBlocation not on record	15
Kew, GB	9
WAGlocation not on record	8
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	7
BRLUlocation not on record	7
University of Stellenboschlocation not on record	6
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	6
St. Augustine, TT	6
Leiden University Medical Centerlocation not on record	5
Plocation not on record	4
LBVlocation not on record	4
Pretoria, ZA	3
Moscow State Universitylocation not on record	3
Herbier National du Gabonlocation not on record	2
JBRJlocation not on record	2
CMULlocation not on record	2
Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record	2
TAFORI-LSRClocation not on record	2
Zürich, CH	2
UFBAlocation not on record	2
MAlocation not on record	2
CNF-UFHBlocation not on record	2
Uppsala, SE	2
VALElocation not on record	1
LGlocation not on record	1
LISClocation not on record	1
IPHAMETRAlocation not on record	1
Seychelles National Herbariumlocation not on record	1
Mexico City, MX	1
EAlocation not on record	1
Beijing, CN	1
Berlin, DE	1
Université du Lomélocation not on record	1
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	1
Daubeny Herbarium, Oxfordlocation not on record	1
Botanic Gardenlocation not on record	1
Elocation not on record	1
arosemena tola, EC	1
Université National du Béninlocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
Nnamdi Azikiwe University Herbarium (NAUH)location not on record	1
University of Hamburglocation not on record	1

45 institutions · 214 of 325 vouchered records shown · 111 without an institution code

09Environmental DNA2 detections

Where the DNA of Cola nitida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 24.1–24.1

Seasonal swing summer↔winter2.90 °C

Max temp (day)28.4 °C

Min temp (night)20.6 °C

Precipitation85.9 mm/mo

Air humidity67.9 %

Moisture balance-30.3 mm/mo

Vapour deficit962 Pa

Wind speed0.9 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)