Cojoba rufescens

(Benth.) Britton & Rose · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Cojoba

At a glance

Occurrence records365

Data sources8

Biological traits20

DNA specimens0

eDNA detections1

Sources8 archives

Databases and archives Cojoba rufescens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility365 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF365 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Cojoba rufescens is a species of flowering plant in the family Fabaceae. It is found in Colombia, Costa Rica, Ecuador, and Panama.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height10.54 m

Plant height max10 m

Seed mass236 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry5

Leaf dry-matter content (LDMC)418 mg/g

Leaf n26.62 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)16.12 mm²/mg

Wood density687 mg/cm³

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cojoba rufescens has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX404617.1 ↗613 bpPanama · 2018

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCACACAAAAAGAGCGACCCGTGAACCGGTTGGAACGAACCTCTGGCGGGGG …

Cojoba rufescens culture STRI:Corteva SJWright MP00026 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type365 records

Wild obs. + sensor46

Museum / vouchered319

Range

Area of Occupancy AOO876 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 9≤1 km 9≤10 km 7>10 km 1

26 georeferenced · 20 without coordinates

Open the mapobservation + sensor46

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 6≤10 km 11>10 km 1

18 georeferenced · 301 without coordinates

Open the institutions mapphysical evidence319

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	198
National Biodiversity Institute, Costa Ricalocation not on record	22
Bronx, US	13
San José, CR	8
Universidad Nacional de Colombia (UNAL)location not on record	8
Universidad de Antioquia (UdeA)location not on record	8
Chicago, US	7
Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record	7
CASlocation not on record	6
Kew, GB	5
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	4
Universidad Tecnológica del Chocó (UTCH)location not on record	4
QCNElocation not on record	3
Jena Microbial Resource Collectionlocation not on record	2
University of Stellenboschlocation not on record	2
Frankfurt am Main	2
Mexico City, MX	2
Provincial Museum of Albertalocation not on record	2
MAlocation not on record	1
G. McPhersonlocation not on record	1
WCS Colombialocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
SCZlocation not on record	1
BMlocation not on record	1
arosemena tola, EC	1
QAPlocation not on record	1
Universidad Autónoma de Chiriquílocation not on record	1
Fundación Desarrollo y Ambiente FUNDAlocation not on record	1
ASUlocation not on record	1
UNESP-RClocation not on record	1
OTSlocation not on record	1

31 institutions · 316 of 319 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Cojoba rufescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)