Cojoba costaricensis

Britton & Rose · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Cojoba

At a glance

Occurrence records237

Data sources7

Biological traits9

DNA specimens8

eDNA detections4

Sources7 archives

Databases and archives Cojoba costaricensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility237 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF237 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Cojoba costaricensis là một loài thực vật có hoa trong họ Đậu. Loài này được Britton & Rose miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cojoba costaricensis has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes3

GenBank sequences8

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJQ594854.1 ↗535 bpCosta Rica · 2007

ACGT

TGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATAGTGATATCTTGGCAGCATTCCGAGTAACTCCTCA …

Cojoba costaricensis voucher RE-5040-1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★rbcLa

plant barcode

08Occurrence & distribution

Record type237 records

Wild obs. + sensor23

Museum / vouchered214

Range

Area of Occupancy AOO380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 23

23 georeferenced

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 214 records without

Open the institutions mapphysical evidence214

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	77
Museo Nacional de Costa Rica (MNCR)location not on record	64
Saint Louis, US	37
San José, CR	12
Bronx, US	6
Mexico City, MX	5
Chicago, US	2
MEXUlocation not on record	2
Antiguo Cuscatlán, SV	2
BMlocation not on record	1
Berlin, DE	1
MAlocation not on record	1
Calabar, NG	1
University of Stellenboschlocation not on record	1

14 institutions · 212 of 214 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Cojoba costaricensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)