Coincya richeri

(Vill.) Greuter & Burdet · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Coincya

At a glance

Occurrence records4 131

Data sources7

Biological traits9

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Coincya richeri's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 131 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF4 131 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 24

01Narrative

Coincya richeri is a plant species in the family Brassicaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Size & morphology3

Plant height0.251 m

Plant height generative0.4 m

Seed mass2.33 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Lifespan years3 years

Habitat & environment2

Climatetemperate

Growth formb H

Physiology & chemistry1

Leaf dry-matter content (LDMC)133 mg/g

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coincya richeri has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF543765.1 ↗744 bpItaly · 1998

ACGT

CGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGT …

Coincya richeri voucher CORIVG16-230698 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Coincya richeri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · book-ipcn67-71 · CCDB · brass

CCDB · book-ipcn67-71 — FAVARGER, c. 1969. Notes de caryologie Alpine V. Bull. Soc. Neuchateloise Sci. Nat. 92: 13-30.

CCDB · brass — Favarger

n 126×CCDB · ita-fl · CCDB · book-ipcn67-71 · CCDB · brass

CCDB · ita-fl — DELAY J. - 1968. Orophytes d'Europe mridionale.. Caryosystematique et Cytogenetique , 2: 13-16.

CCDB · book-ipcn67-71 — DELAY, J. 1968. Orophytes d'Europe meridionale. Inf. Ann. Caryosyst. et Cytogenet. 2: 13-16.

CCDB · book-ipcn67-71 — FAVARGER, c. 1969. Notes de caryologie Alpine V. Bull. Soc. Neuchateloise Sci. Nat. 92: 13-30.

CCDB · brass — Delay

CCDB · brass — Favarger

CCDB · brass — Leadlay & Heywood

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 131 records

Wild obs. + sensor4 066

Museum / vouchered65

Range

Area of Occupancy AOO912 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 194≤1 km 714≤10 km 2 215>10 km 579

3 702 georeferenced · 364 without coordinates

Open the mapobservation + sensor4 066

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 51>10 km 13

64 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence65

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oskarshamn, SE	1

1 institutions · 1 of 65 vouchered records shown · 64 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Coincya richeri

At a glance

Sources7 archives

Size & morphology3

Life cycle & reproduction3

Habitat & environment2

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 131 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 1 geolocated

Record type4 131 records