Coffea racemosa

Lour. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Coffea

At a glance

Occurrence records81

Data sources12

Biological traits22

DNA specimens9

eDNA detections7

Sources12 archives

Databases and archives Coffea racemosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility81 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF81 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB · GoaT498 Mbp

01Narrative

Coffea racemosa é uma espécie de angiosperma da família Rubiaceae. Tem níveis naturalmente baixos de cafeína, menos da metade do encontrado no Coffea arabica, e um quarto do Coffea canephora. É endêmica do cinturão florestal costeiro entre o norte de KwaZulu-Natal na África do Sul e Zimbábue, encontrado em uma área inferior a 150 km⁲ (58 sq mi) de tamanho. Foi amplamente cultivada pelos portugueses durante os anos 1960-1970 em Moçambique, atualmente existem apenas duas plantações na Ilha do Ibo e em Hluhluwe, que permanecem. Coffea racemosa é um arbusto de ramificação aberta ou pequena árvore que cresce até 3.5 m (11 ft) de altura. Possui flores singulares brancas a rosadas com cerca de 2 cm (1 in) de diâmetro ou em cachos com poucas flores ao longo dos ramos, que florescem entre setembro e fevereiro. A fruta é de forma quase esférica e roxa à preta quando madura. A fruta é colhida na natureza para uso local como café. Os grãos são um terço do tamanho dos grãos arábica. Os grãos são torrados e moídos até virarem pó e depois são usados para fazer café. O sal às vezes é polvilhado sobre eles enquanto são assados.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height1.2 m

Plant height max6 m

Plant height min2 m

Seed mass41.7 mg

Seed mass max41.7 mg

Seed mass min41.7 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max90 m

Elevation min30 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition8 compounds

Compounds documented for Coffea racemosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Stigmastane steroids3

Cholestane steroids $ Stigmastane steroids2

Tetracyclic diterpenoids1

Norkaurane diterpenoids1

Pyridine alkaloids1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Clerosterol	present	LOTUS
(3S,5R,9R,10S,13R,14R,17R)-17-((2R,5R)-5-ethyl-6-methylheptan-2-yl)-10,13-dimethyl-2,3,4,5,6,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta(a)phenanthren-3-ol	present	LOTUS
(3S,5R,9S,10S,13R,14S,17S)-10,13-dimethyl-17-[(Z,2R)-5-propan-2-ylhept-5-en-2-yl]-2,3,4,5,6,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
(3S,5S,8S,9S,10S,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
beta-Sitosterol	present	LOTUS
Cafestol	present	LOTUS
Kahweol	present	LOTUS
Trigonelline	present	LOTUS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coffea racemosa has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLNC_083906.1 ↗154 942 bp

ACGT

TGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTCTACTCTATT …

Coffea racemosa plastid, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK8★rbcL2★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Coffea racemosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size497 557 499 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Coffea racemosa0.50 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 225×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Cros J, Gavalda MC, Chabrillange N, Récalt C, Duperray C, Hamon S. 1994. Variations in the total nuclear DNA content in African Coffea species (Rubiaceae). Café Cacao 38: 3-10.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type81 records

Wild obs. + sensor13

Museum / vouchered62

Other6

Origin

Native5

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy23% within 1 km

≤100 m 1≤1 km 2≤10 km 3>10 km 7

13 georeferenced

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban, ZA	19
Instituto de Investigação Científica Tropicallocation not on record	17
Pretoria, ZA	15
Istituto Agrario Castelnuovolocation not on record	3
University of Johannesburglocation not on record	1
Kew, GB	1
MeiseBGlocation not on record	1
Buffelskloof Private Nature Reserve, Herbariumlocation not on record	1
UJlocation not on record	1

9 institutions · 59 of 62 vouchered records shown · 2 without an institution code

09Environmental DNA7 detections

Where the DNA of Coffea racemosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 20.2–25.7

Seasonal swing summer↔winter6.80 °C

Max temp (day)28.1 °C 25.4–30.2

Min temp (night)18.8 °C 15.6–21.8

Precipitation93.4 mm/mo 21.4–166

Air humidity62.2 % 59.4–64.2

Moisture balance-16.3 mm/mo -56.5–29.9

Vapour deficit1,082 Pa 950–1,183

Wind speed1.80 m/s 1.30–1.90

Cloud cover31.7 % 16.3–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)