Coffea magnistipula — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Coffea

At a glance

Occurrence records95

Data sources9

Biological traits9

DNA specimens2

eDNA detections1

Sources9 archives

Databases and archives Coffea magnistipula's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility95 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF95 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Coffea magnistipula is a species of flowering plant in the family Rubiaceae. It is a shrub species of Coffea that is endemic to the Lower Guinean forests of tropical West Africa, specifically the South Cameroon Plateau and the Chaillu Massif of Gabon. Its scientific name is derived from the large stipules in which rain water and debris collects. The plant is unusual among Coffea species in having adventitious roots.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coffea magnistipula has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSDQ153640.1 ↗781 bp

ACGT

GACGTGAGCGGTTCGCTGCCCGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTA …

Coffea magnistipula 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5PITS1ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type95 records

Museum / vouchered86

Other9

Range

Area of Occupancy AOO116 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence86

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	18
LBVlocation not on record	17
BRLUlocation not on record	8
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	5
Plocation not on record	5
WAGlocation not on record	5
Paris, FR	4
MeiseBGlocation not on record	4
Brussels, BE	4
Herbier National du Gabonlocation not on record	4
IPHAMETRAlocation not on record	3
Kew, GB	2
Glocation not on record	1

13 institutions · 80 of 86 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Coffea magnistipula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.