Coffea arabica
speciesAt a glance
Occurrence records13 123
Data sources19
Biological traits141
DNA specimens27
eDNA detections23
Sources19 archives
Databases and archives Coffea arabica's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility13 106 records↗
OBISOcean Biodiversity Information System17 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics27 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
foodatlascompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources141 traits
Chemical compositionFooDB · FoodAtlas · LOTUS · NPASS4 715 compounds
Occurrence & distributionGBIF · OBIS13 123 records
Environmental DNA2 datasets · 5 countries23 detections
DNA & barcodingBOLD · NCBI27 specimens
Genome at a glanceCCDB · GIFT · GoaT1.2 Gbp
01Narrative
Le caféier d'Arabie (Coffea arabica) est un arbuste de la famille des Rubiacées, cultivé pour produire les grains de café arabica. Autres noms communs : Café arabica, caféier.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology23
Fruit length14 mm
Fruit length max18 mm
Fruit length min10 mm
Fruit width12.5 mm
Fruit width max15 mm
Fruit width min12 mm
Leaf length125 mm
Leaf length max200 mm
Leaf length min60 mm
Leaf size4 085 mm²
Leaf width52.5 mm
Leaf width max75 mm
Leaf width min25 mm
Plant height5.8 m
⚠ sources differ — GIFT: 5.8 m · AusTraits: 5.5 m · USDA: 4.57 m · TRY: 2.01 m
Plant height max5 m
Plant height min2 m
Seed length12 mm
Seed mass157 mg
⚠ sources differ — TRY: 157 mg · GIFT: 321 mg
Seed mass max472 mg
Seed mass min132 mg
Seed volume440 mm³
Seed volume max440 mm³
Seed volume min440 mm³
Life cycle & reproduction33
Bloom periodSpring
Coppice potentialNo
Deciduousnessevergreen
Dispersal type detailedanthropochorous
Flower colourwhite
Flower conspicuousYes
Flower length max8 mm
Flower length min7 mm
Flowering endSep
Flowering startJul
Flowering timennnnnnnnnyyn
Fruit seed period beginSpring
Fruit seed period endFall
Growth rate USDAModerate
Life formshrub or tree
Life spanperennial
Lifespan categoryModerate
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Resprout abilityYes
Seed spread rateNone
Seedling vigorMedium
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment35
Active growth periodYear Round
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 600 m
Elevation mean1 500 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterDense
Foliage textureMedium
Fruit colourgreen
⚠ sources differ — GIFT: green · USDA: Red
Fruit fleshinessfleshy
Fruit typedrupe
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: tree · TRY: Tree crop
Growth form USDAMultiple Stem
Habitat GIFTÁrea Antrópica
Hedge toleranceHigh
Known allelopathNo
Leaf compoundnesssimple
Leaf formelliptic
Leaf retentionYes
Leaf shapeelliptical oblong widely_elliptical
Low growing grassNo
Mycorrhiza type0.00000038
Root depth min40 in
Shape and orientationRounded
Small grainNo
Succulenceno
Woodinesswoody
Physiology & chemistry27
Anaerobic toleranceLow
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementHigh
Fire resistantNo
Fire toleranceNone
Frost free days min365 days
Leaf C:N ratio15.17 g/g
Leaf c462 mg/g
Leaf dry-matter content (LDMC)253 mg/g
Leaf n32.57 mg/g
Leaf p1.26 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max100 in
Precipitation min60 in
Salinity toleranceLow
Shade toleranceLow
Soil pH max7.5 pH
Soil pH min4 pH
Specific leaf area (SLA)16.44 mm²/mg
Temperature min17 °F
Wood density611 mg/cm³
Uses & economy13
Berry nut seed productYes
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound1 000 per lb
ToxicityNone
Veneer productNo
Other traits9
Fall conspicuousYes
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceNo
Inflorescencecyme
Leaf arrangementopposite
Planting density max1 100 per acre
Planting density min700 per acre
Seeds per fruit1-10
03Chemical composition4 715 compounds
Compounds documented for Coffea arabica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingCoffee and coffee products
Compound class profile5 classes
Aminoacids149
Cinnamic acids and derivatives90
Pyridine alkaloids74
Glycerophospholipids57
pteridine alkaloids41
Documented compounds4 715 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Sugars | 69,160 mg/100g | FooDB | |
| Starch, pregelatinized | 28,500 mg/100 g | FooDB | |
| α-D-galactose | 28,500 mg/100g | FooDB | |
| Chinese tannin | 9,000 mg/100g | FooDB | |
| Sucrose | 6,500 mg/100 g | FooDB | |
| alpha-Linolenic acid | 5,265 mg/100g | FooDB |
05DNA & barcoding27 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coffea arabica has left across the world's sequence archives.
At a glance
DNA specimens27
Marker genes6
GenBank sequences10
eDNA detections23
Countries5
The DNA barcodea real sequence read deposited for this species
GTTCGCGACATCGAAGTTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGC …
Coffea arabica voucher HWC 690 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL7★ITS2★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Coffea arabica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 224 945 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Coffea arabica1.22 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 44 n = 22
Ploidy4× tetraploid · measured
Chromosome records22–882n range44median44mode25records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4418×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +5
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Shibata, K. 1962. Estudios citologicos de plantas colombianas silvestres y cultivadas. J. Agric. Sci. (Tokyo). 8: 49–62.
CCDB · ipcn-api-dl — Dutta, M. 1985. Karyomorphological study of three species of Rubiaceae. Proc. Indian Sci. Congr. Assoc. 72(3–VI): 125.
CCDB · ipcn-api-dl — Xena de Enrech, N., A. Menendez-Yuffa & A. A. Huerfano. 1996. Estabilidad del numero cromosomico en cultivares y embriones somaticos de cafe (Coffea sp.). Acta Bot. Venez. 19(1): 5–15.
CCDB · book-ipcn75-78 — Majumdar 1975
CCDB · book-ipcn75-78 — Rijo 1974
CCDB · book-indian_vol1 — Fagerlind, F. 1934, 1937; Krug, C.A. 1934; Doutreligne, J. 1939; Mendes, A.J.T. & Bacchi, O. 1940 ; Mendes;. A.J.T. 1945; Bouharmont, J. 1959 ; Majumdar, L. 1971, 1975 ; Williams, J.A.1972
CCDB · book-fedorov — Fagerlind 1934, 1937
CCDB · book-fedorov — K.rug 1934
CCDB · book-fedorov — Doutreligne 1939
CCDB · book-atlas-flowering-plants — Mendes 1945
CCDB · Cave1963 — Shibata 1962
GIFT · GIFT (floras)
2n 224×CCDB · book-fedorov · GIFT · GIFT (floras)
CCDB · book-fedorov — Homeyer 1932
CCDB · book-fedorov — Bacchi 1941
CCDB · book-fedorov — Sybenga 1960
GIFT · GIFT (floras)
2n 882×CCDB · book-indian_vol1 · GIFT · GIFT (floras)
CCDB · book-indian_vol1 — Chinappa, C.C. 1969
GIFT · GIFT (floras)
2n 661×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 222×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Bir, S. S. & G. S. Chatha. 1987. Meiotic analysis of woody elements of south Indian Rubiaceae. Nucleus (Calcutta) 30: 114–124.
CCDB · ipcn-api-dl — Pinto-Maglio, C. A. F. & N. D. d. Cruz. 1998. Pachytene chromosome morphology in Coffea L. II. C. arabica L. complement. Caryologia 51: 19–35.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness95.8% BUSCO
08Occurrence & distribution
Record type13 123 records
Wild obs. + sensor9 982
Museum / vouchered2 784
Cultivated / captive31
Other326
Origin
Native1
Introduced588
Range
Area of Occupancy AOO20 504 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy63% within 1 km
≤100 m 4 232≤1 km 634≤10 km 2 710>10 km 188
7 764 georeferenced · 2 218 without coordinates
Open the mapobservation + sensor9 982
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy74% within 1 km
≤100 m 354≤1 km 93≤10 km 109>10 km 51
607 georeferenced · 2 177 without coordinates
Open the institutions mapphysical evidence2 784
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy67% within 1 km
≤100 m 1≤1 km 1≤10 km 1
3 georeferenced · 28 without coordinates
Open the mapnot free-living31
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions142 of 294 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Istituto Agrario Castelnuovolocation not on record | 293 |
| Saint Louis, US | 274 |
| Durango, MX | 219 |
| Tapachula, MX | 120 |
| Bronx, US | 90 |
| Mexico City, MX | 59 |
| Chapingo, MX | 54 |
| MeiseBGlocation not on record | 42 |
| Chicago, US | 34 |
| University of Stellenboschlocation not on record | 34 |
| National Biodiversity Institute, Costa Ricalocation not on record | 32 |
| UTPLlocation not on record | 30 |
| Smithfield, AU | 29 |
| Brisbane, AU | 26 |
| Taipei, TW | 25 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 22 |
| Tampa, US | 20 |
| JBRJlocation not on record | 19 |
| MAlocation not on record | 19 |
| Auckland, NZ | 19 |
| Honolulu, US | 18 |
| BISHlocation not on record | 18 |
| Universidad de Caldas (UCaldas)location not on record | 18 |
| Université de Strasbourglocation not on record | 18 |
| Göteborg, SE | 18 |
| Puerto Ayora, EC | 17 |
| Universidad Nacional de Colombia (UNAL)location not on record | 17 |
| La Paz, BO | 16 |
| Denver, US | 16 |
| Taipei, TW | 15 |
| Chaguaramas, TT | 14 |
| Mexico City, MX | 14 |
| University of the Philippines Los Baños Museum of Natural Historylocation not on record | 13 |
| Mexico City, MX | 13 |
| Miami, US | 13 |
| Beijing, CN | 12 |
| UFBAlocation not on record | 12 |
| Universidad Industrial de Santander (UIS)location not on record | 12 |
| Altos de Pipe, VE | 12 |
| Blumenau, BR | 12 |
| Universidad de La Salle (La Salle)location not on record | 12 |
| Antiguo Cuscatlán, SV | 12 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 12 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 12 |
| León, NI | 11 |
| Stockholm, SE | 11 |
| Instituto do Meio Ambientelocation not on record | 11 |
| Austin, US | 11 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 10 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 10 |
| Maringá, BR | 10 |
| Chongqing Museumlocation not on record | 10 |
| Berlin, DE | 10 |
| Kew, GB | 9 |
| UEPAlocation not on record | 9 |
| Paris, FR | 9 |
| Autlán de Navarro, MX | 9 |
| Santa Cruz de la Sierra, BO | 9 |
| Chengdu, CN | 9 |
| Mérida, MX | 9 |
| Laboratorio de Ictiologialocation not on record | 9 |
| Pondicherry, IN | 9 |
| QCNElocation not on record | 8 |
| Tlalnepantla, MX | 8 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 8 |
| Universidade de São Paulolocation not on record | 8 |
| Christchurch, NZ | 8 |
| Canberra, AU | 8 |
| ESALQlocation not on record | 8 |
| Departamento de Sistematica e Ecologialocation not on record | 8 |
| Tuxtla Gutiérrez, MX | 7 |
| Austin, US | 7 |
| UNICAMPlocation not on record | 7 |
| Universidad del Valle (UV)location not on record | 7 |
| Strecker Museum, Baylor Universitylocation not on record | 7 |
| Guangzhou, CN | 7 |
| Baroda, IN | 7 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 7 |
| Moscow State Universitylocation not on record | 7 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 7 |
| Ilhéus, BR | 7 |
| UEMlocation not on record | 7 |
| PUC-RSlocation not on record | 6 |
| Criciúma, BR | 6 |
| Riverside, US | 6 |
| UNESClocation not on record | 6 |
| Aarhus, DK | 6 |
| Fortaleza, BR | 6 |
| UNEMATlocation not on record | 6 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 6 |
| Ivano-Frankivsk, UA | 6 |
| UFRRJlocation not on record | 6 |
| Universidad Católica de Oriente (UCO)location not on record | 6 |
| Wellington, NZ | 6 |
| Guilin, CN | 5 |
| UFMSlocation not on record | 5 |
| Salvador, BR | 5 |
| Xiamen, CN | 5 |
| Durban, ZA | 5 |
| Tuxtla Gutiérrez, MX | 5 |
| UERJlocation not on record | 5 |
| Mexico City, MX | 5 |
| Mount Annan, AU | 5 |
| The University and Jepson Herbarialocation not on record | 5 |
| 云南省思茅市民族传统医药研究所location not on record | 5 |
| Montecillo, Texcoco, MX | 5 |
| Feira de Santana, BR | 5 |
| Guatemala City, GT | 5 |
| USP-IBlocation not on record | 5 |
| Fort Worth, US | 4 |
| UFOPlocation not on record | 4 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 4 |
| FFPRIlocation not on record | 4 |
| Museu Paraense Emílio Goeldilocation not on record | 4 |
| Foz do Iguaçu, BR | 4 |
| UTFPR-CPlocation not on record | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| UFRPElocation not on record | 4 |
| Sucre, BO | 4 |
| Campo Mourão, BR | 4 |
| Uppsala, SE | 4 |
| Herbario MAT de la Universidad Politécnica Estatal del Carchilocation not on record | 4 |
| CEPLAClocation not on record | 4 |
| Bloomington, US | 4 |
| Londrina, BR | 4 |
| Nishihara, JP | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Fredericksburg, US | 4 |
| Brasília, BR | 4 |
| UnBlocation not on record | 4 |
| Cenargenlocation not on record | 3 |
| Cochabamba, BO | 3 |
| UEMAlocation not on record | 3 |
| Davis, US | 3 |
| Universidad Autónoma de Madridlocation not on record | 3 |
| ASUlocation not on record | 3 |
| EL PASO, US | 3 |
| HUAlocation not on record | 3 |
| St. Augustine, TT | 3 |
| Universidade Federal de Goiáslocation not on record | 3 |
| Universidade Federal de Sergipe (UFS)location not on record | 3 |
| Brasília, BR | 3 |
| UFPElocation not on record | 3 |
| Universidade Federal de Santa Catarinalocation not on record | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| Masindi, UG | 3 |
| UNESP-FCAlocation not on record | 3 |
| Herbier National du Gabonlocation not on record | 3 |
| UESBlocation not on record | 3 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 3 |
| UFSClocation not on record | 3 |
| Universidad Nacional de Asunciónlocation not on record | 3 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 3 |
| Chengdu, CN | 3 |
| Chicago, US | 3 |
| HUENFlocation not on record | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 2 |
| Firenze, IT | 2 |
| Bogotá, D.C., CO | 2 |
| Universidad Nacional Agrarialocation not on record | 2 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 2 |
| MEXUlocation not on record | 2 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 2 |
| INMAlocation not on record | 2 |
| UFVJMlocation not on record | 2 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 2 |
| Beijing Natural History Museumlocation not on record | 2 |
| TAFORI-LSRClocation not on record | 2 |
| Seropédica, BR | 2 |
| Pretoria, ZA | 2 |
| Edinburgh, GB | 2 |
| Chengdu, CN | 2 |
| Southwest Forestry Collegelocation not on record | 2 |
| Gump Stationlocation not on record | 2 |
| Sangmiung Universitylocation not on record | 2 |
| South Kensington, GB | 2 |
| Cruz das Almas, BR | 2 |
| Angwin, US | 2 |
| Xian, CN | 2 |
| National Museums of Kenyalocation not on record | 2 |
| Loja, EC | 2 |
| James Cook Townsvillelocation not on record | 2 |
| Universiti Sains Malaysialocation not on record | 2 |
| Adelaide, AU | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| IPA/SPlocation not on record | 2 |
| Karlsruhe, DE | 2 |
| Instituto de Investigação Científica Tropicallocation not on record | 2 |
| Plocation not on record | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| Leiden University Medical Centerlocation not on record | 2 |
| San Francisco, US | 2 |
| Universidad de Nariño (UdeNar)location not on record | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| UNESP-FCAVlocation not on record | 2 |
| Nanjing, CN | 2 |
| Centro Cultural Santo Domingolocation not on record | 2 |
| Madison, US | 2 |
| Jataí / Setor Industrial, BR | 2 |
| Ann Arbor, US | 2 |
| Odawara, JP | 1 |
| UNIVASFlocation not on record | 1 |
| UFESlocation not on record | 1 |
| Xinxiang, CN | 1 |
| Corrientes, AR | 1 |
| MEDELlocation not on record | 1 |
| CMULlocation not on record | 1 |
| BMlocation not on record | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| Barcelona, ES | 1 |
| UFPRlocation not on record | 1 |
| Phoenix, US | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Whitewater, US | 1 |
| Cambridge University Herbariumlocation not on record | 1 |
| Montréal, CA | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Cascavel, BR | 1 |
| Federal University of Espírito Santolocation not on record | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Lubbock, US | 1 |
| MUFALlocation not on record | 1 |
| Uberlândia, BR | 1 |
| UNISANTAlocation not on record | 1 |
| Toluca, MX | 1 |
| Iquitos, PE | 1 |
| Wlocation not on record | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Cuiabá, BR | 1 |
| Calabar, NG | 1 |
| Zlocation not on record | 1 |
| Shanghai, CN | 1 |
| Changsha, CN | 1 |
| Montpellier, FR | 1 |
| University of Dar es Salaamlocation not on record | 1 |
| Guiyang, CN | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| HEMlocation not on record | 1 |
| LBVlocation not on record | 1 |
| Yangling, CN | 1 |
| Jinghong, CN | 1 |
| UTFPR-DVlocation not on record | 1 |
| Taipei, TW | 1 |
| Smithsonian Institution, National Museum of Natural Historylocation not on record | 1 |
| Cambridge, US | 1 |
| Lake Charles, US | 1 |
| UFABClocation not on record | 1 |
| Coimbra, PT | 1 |
| UNESP-IBILCElocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Hobart, AU | 1 |
| Burlington, US | 1 |
| Porrentruy, CH | 1 |
| Universität Göttingenlocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| TAIElocation not on record | 1 |
| Mérida, MX | 1 |
| Quito, EC | 1 |
| Bangkok, TH | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Millersville, US | 1 |
| Morelia, MX | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Cuenca, EC | 1 |
| McWane Science Centerlocation not on record | 1 |
| CJBGlocation not on record | 1 |
| St. Paul, US | 1 |
| Rotorua, NZ | 1 |
| San Francisco de Campeche, MX | 1 |
| Cincinnati, US | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Chapel Hill, US | 1 |
| QAPlocation not on record | 1 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
| Universidad Autónoma de Nayaritlocation not on record | 1 |
| San Luis Potosí, MX | 1 |
| UNESP-RClocation not on record | 1 |
| Port Elizabeth Museum (Bayworld)location not on record | 1 |
| Castelar, AR | 1 |
| Riobamba, EC | 1 |
| COLlocation not on record | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| UNIVILLElocation not on record | 1 |
| Yaoundé, CM | 1 |
| San José, CR | 1 |
| OTSlocation not on record | 1 |
| arosemena tola, EC | 1 |
| LGlocation not on record | 1 |
| HNBlocation not on record | 1 |
| HUT Culture Collectionlocation not on record | 1 |
294 institutions · 2 622 of 2 784 vouchered records shown · 137 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA23 detections
Where the DNA of Coffea arabica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found23
Studies independent surveys2
Countries5
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 23 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.4 °C 14.5–25.1
Seasonal swing summer↔winter10.2 °C
Max temp (day)23.3 °C 19.2–30.4
Min temp (night)13.2 °C 9.00–20.6
Precipitation175 mm/mo 109–212
Air humidity61.0 % 52.5–62.3
Moisture balance61.4 mm/mo -42.7–83.7
Vapour deficit827 Pa 645–1,589
Wind speed1.80 m/s 1.10–4.80
Cloud cover25.2 % 21.0–35.9
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.