Coenonympha california

Westwood · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Coenonympha

At a glance

Occurrence records25 959

Data sources6

Biological traits0

DNA specimens260

eDNA detections9

Sources6 archives

Databases and archives Coenonympha california's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 959 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics260 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF25 959 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD260 specimens

01Narrative

Coenonympha california is een vlinder uit de onderfamilie Satyrinae van de familie Nymphalidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1851 door John Obadiah Westwood.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding260 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coenonympha california has left across the world's sequence archives.

At a glance

DNA specimens260

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus256 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

56Cmostly conserved

106Cmostly conserved

200Gmostly conserved

205Tmostly conserved

212Cmostly conserved

355Tmostly conserved

433Amostly conserved

478Amostly conserved

511Amostly conserved

589Tmostly conserved

616Cmostly conserved

622Tmostly conserved

631Avariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCCCTTAGTCTAATTATTCGAACTGAACTAGGTAATCCAGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 44 variants.

Diversity (π)0.59%

Haplotypes44

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Coenonympha tulliasame genus3.3%Coenonympha amaryllissame genus3.5%Coenonympha caecasame genus4.1%Coenonympha corinnasame genus6.1%Coenonympha thyrsissame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type25 959 records

Wild obs. + sensor25 111

Museum / vouchered831

Other17

Range

Area of Occupancy AOO45 064 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 10 743≤1 km 5 070≤10 km 1 667>10 km 1 021

18 501 georeferenced · 6 610 without coordinates

Open the mapobservation + sensor25 111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 11≤1 km 173≤10 km 276>10 km 95

555 georeferenced · 276 without coordinates

Open the institutions mapphysical evidence831

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	323
White River Junction, US	199
Cambridge, US	124
OSUClocation not on record	47
Natural History Museum of Utahlocation not on record	29
Santa Cruz, US	19
Denver, US	16
MZLUlocation not on record	15
ASUlocation not on record	12
Mexico City, MX	8
Royal Saskatchewan Museumlocation not on record	8
University Park, US	6
San Diego, US	3
Tartu, EE	3
National Institute of Biological Resourceslocation not on record	3
Cornell University Insect Collectionlocation not on record	3
Chicago, US	2
Uniwersytet Łódzkilocation not on record	1
Georgia Museum of Natural Historylocation not on record	1
Yokosuka City Museumlocation not on record	1
Research Collection of Norbert G. Kondlalocation not on record	1
Champaign, US	1

22 institutions · 825 of 831 vouchered records shown · 6 without an institution code

09Environmental DNA9 detections

Where the DNA of Coenonympha california was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 15.9–20.4

Seasonal swing summer↔winter23.5 °C

Max temp (day)25.0 °C 19.2–27.7

Min temp (night)12.1 °C 10.7–12.2

Precipitation12.8 mm/mo 10.0–126

Air humidity47.9 % 33.4–63.6

Moisture balance-158 mm/mo -165–7.60

Vapour deficit1,067 Pa 659–1,599

Wind speed2.40 m/s 2.40–2.60

Cloud cover23.2 % 13.2–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Coenonympha california

At a glance

Sources6 archives

At a glance

Record type25 959 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type25 959 records