Coelospermum reticulatum

(F.Muell.) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Coelospermum

At a glance

Occurrence records2 033

Data sources8

Biological traits35

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Coelospermum reticulatum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 033 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF2 033 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Coelospermum reticulatum is a species of flowering plant in the family Rubiaceae. It is native to New Guinea, the Northern Territory, and Queensland. Its natural habitat is dry rainforest and moister Eucalyptus woodland. The plant is an important source of dye for Aboriginal people. The former genus Pogonolobus with its sole species, Pogonolobus reticulatus, has been synonymised with this species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Leaf length70 mm

Leaf mass per area123 g/m2

Leaf size2 002 mm²

Leaf width55 mm

Plant height3.5 m

⚠ sources differ — AusTraits: 3.5 m · TRY: 3 m

Plant height max5 m

Plant height min1 m

Seed mass49.67 mg

⚠ sources differ — TRY: 49.67 mg · AusTraits: 44.86 mg · GIFT: 53.52 mg

Seed mass max53.52 mg

Seed mass min53.52 mg

Life cycle & reproduction7

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennnnnnnyyyyy

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: tree · TRY: climber

Leaf compoundnesssimple

Leaf shapeovate

Woodinesswoody

Physiology & chemistry7

Leaf c460 mg/g

Leaf dry-matter content (LDMC)460 mg/g

Leaf n11.14 mg/g

Leaf p0.499 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)8.16 mm²/mg

03Chemical composition1 compounds

Compounds documented for Coelospermum reticulatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthraquinones and anthrones1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Lucidin		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coelospermum reticulatum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFJ907096.1 ↗756 bp

ACGT

GGATTGCGGCGACGTGAGCGGACGCTGCCCGCGACGTCGCAAGAAGTTCGCTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAG …

Pogonolobus reticulatus voucher Q8840 (BRI) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type2 033 records

Wild obs. + sensor798

Museum / vouchered665

Other570

Origin

Native50

Range

Area of Occupancy AOO5 720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 392≤1 km 25≤10 km 16>10 km 12

445 georeferenced · 353 without coordinates

Open the mapobservation + sensor798

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 139≤1 km 32≤10 km 357>10 km 88

616 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence665

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	257
Palmerston, AU	98
Smithfield, AU	95
Canberra, AU	72
Museo Entomologico de Leonlocation not on record	62
Mount Annan, AU	34
Kew, GB	12
James Cook Townsvillelocation not on record	10
John T. Waterhouse Herbariumlocation not on record	8
Armidale, AU	7
Adelaide, AU	3
Stockholm, SE	2
Hobart, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1

14 institutions · 663 of 665 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Coelospermum reticulatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.8 °C 20.8–20.8

Seasonal swing summer↔winter10.4 °C

Max temp (day)25.9 °C

Min temp (night)16.4 °C

Precipitation90.9 mm/mo

Air humidity57.4 %

Moisture balance-19.5 mm/mo

Vapour deficit1,056 Pa

Wind speed1.90 m/s

Cloud cover26.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Coelospermum reticulatum

At a glance

Sources8 archives

Size & morphology10

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

Physiology & chemistry7

Compound class profile1 class

Documented compounds1 total

At a glance

Record type2 033 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 033 records