Coelogyne nitida

(Wall. ex D.Don) Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Coelogyne

At a glance

Occurrence records102

Data sources12

Biological traits9

DNA specimens17

eDNA detections17

Sources12 archives

Databases and archives Coelogyne nitida's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility102 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS · NPASS89 compounds

Occurrence & distributionGBIF102 records

Environmental DNA1 datasets · 0 countries17 detections

DNA & barcodingBOLD · NCBI17 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Coelogyne nitida est une espèce d'orchidées du genre Coelogyne originaire d'Asie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Elevation max3 000 m

Elevation min1 380 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Woodinessnon-woody

03Chemical composition89 compounds

Compounds documented for Coelogyne nitida across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Piperidine alkaloids25

Phenanthrenes10

N-acyl amines8

Cinnamic acids and derivatives3

Bisabolane sesquiterpenoids3

Documented compounds89 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,5R,6S)-2,6-bis(1,3-benzodioxol-5-yl)-N-(2-methylpropyl)-5-(piperidine-1-carbonyl)cyclohex-3-ene-1-carboxamide	present	NPASS
(1S,2R,5R)-2-methyl-5-[(2S)-6-methylhept-5-en-2-yl]cyclohex-3-ene-1,2-diol	present	NPASS
(1S,2S,5R,6R)-5,6-bis(1,3-benzodioxol-5-yl)-N-(2-methylpropyl)-2-(piperidine-1-carbonyl)cyclohex-3-ene-1-carboxamide	present	NPASS
(1S,4R,5R)-2-methyl-5-[(2S)-6-methylhept-5-en-2-yl]cyclohex-2-ene-1,4-diol	present	NPASS
(1S,4R,5R,6S)-N-(2-methylpropyl)-6-[(E)-3-(2-methylpropylamino)-3-oxoprop-1-enyl]-4,5-dipentylcyclohex-2-ene-1-carboxamide	present	NPASS
(2E,12E)-13-(1,3-benzodioxol-5-yl)-N-(2-methylpropyl)trideca-2,12-dienamide	present	NPASS
(2E,4E)-5-(1,3-benzodioxol-5-yl)-N-(3-methylbutyl)penta-2,4-dienamide	present	NPASS
(2E,4E)-5-(1,3-benzodioxol-5-yl)-N-[(2R)-2-methylbutyl]penta-2,4-dienamide	present	NPASS
(2E,4E)-5-(2H-1,3-benzodioxol-5-yl)-N-[(5E)-10-methylundec-5-en-1-yl]penta-2,4-dienamide	present	NPASS
(2E,4E,12Z)-N-(2-Methylpropyl)-2,4,12-octadecatrienamide	present	NPASS

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coelogyne nitida has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes4

GenBank sequences10

eDNA detections17

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMK169297.1 ↗651 bpIndia · 2016

ACGT

GAACCCGTGAAATAAGCGACGGCAGTTGCTGCCGTAGAACAACCATCCCAGTCGTTGCCTTGTCTCTTTCGGGGGGGAGGGCAATGATGA …

Coelogyne nitida voucher DS0029 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL5★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Coelogyne nitida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records40–402n range40median40mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 405×CCDB · ipcn-api-dl · CCDB · book-indian_vol2 · CCDB · eflora

CCDB · ipcn-api-dl — Vijayakumar, N. & D. Subramanian. 1994. Karyomorphological studies of Orchidaceae from Tamilnadu. Cell Chromosome Res. 17(1): 40–47.

CCDB · ipcn-api-dl — Sau, H. & A. K. Sharma. 1983. Chromosome evolution and affinity of certain genera of Orchidaceae. Cytologia 48: 363–372.

CCDB · book-indian_vol2 — Mehra, P.N. & Vij, S.P. 1970 ; Vij, S.P. & Mebra, P.N. 1976

CCDB · eflora

n 202×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — VIJ, S. P. & N. Shekhar. 1983. In: IOPB chromosome number reports LXXXI. Taxon 32: 668.

CCDB · book-ipcn67-71 — MEHRA, P.N., & S.P. VIJ. 1970. In IOPB chromosome number reports XXV. Taxon 19: 102-113.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type102 records

Wild obs. + sensor65

Museum / vouchered35

Cultivated / captive2

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 23≤1 km 8≤10 km 5>10 km 4

40 georeferenced · 25 without coordinates

Open the mapobservation + sensor65

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤1 km 14≤10 km 1

15 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence35

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	21
Edinburgh, GB	6
Beijing, CN	3

3 institutions · 30 of 35 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA17 detections

Where the DNA of Coelogyne nitida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)