Coelogyne cristata

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Coelogyne

At a glance

Occurrence records127

Data sources13

Biological traits10

DNA specimens23

eDNA detections23

Sources13 archives

Databases and archives Coelogyne cristata's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility127 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS6 compounds

Occurrence & distributionGBIF127 records

Environmental DNA1 datasets · 0 countries23 detections

DNA & barcodingBOLD · NCBI23 specimens

Genome at a glanceCCDB · GoaT3.3 Gbp

01Narrative

Coelogyne cristata is an epiphytic orchid that comes from cool, moist areas of the eastern Himalayas and Vietnam. It blooms every spring, before the snow begins to melt. Its genus name Coelogyne originates from two Greek words, (“hollow”) and (“woman”), because of the orchid’s pistil. Cristata takes its species name from , the Latin word for “comb”, because of the look of the flower’s lip.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous lithophyte

Lifeform raunkiaer detailedlithophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Elevation max2 600 m

Elevation min1 300 m

Epiphyteobligatory

Growth formherb

Woodinessnon-woody

03Chemical composition6 compounds

Compounds documented for Coelogyne cristata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Phenanthrenes7

Steroidal alkaloids1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
7,8-dimethoxy-9,10-dihydro-5H-naphtho(8,1,2-cde)chromene-2,6-diol	present	LOTUS
7,8-Dimethoxy-9,10-dihydrophenanthrene-2,4,6-triol	present	LOTUS
BAWFJGJZGIEFAR-NNYOXOHSSA-M	present	NPASS
Coeloginanthrin	present	LOTUS
Coeloginin	present	LOTUS
Solasonine	present	NPASS

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coelogyne cristata has left across the world's sequence archives.

At a glance

DNA specimens23

Marker genes4

GenBank sequences10

eDNA detections23

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPV928937.1 ↗478 bpPoland · 2023

ACGT

GCCGTCGCACAACATGTGGATTAAAACGACTCTTGGCAAAGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGT …

Coelogyne cristata voucher C11 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL7★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Coelogyne cristata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 325 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Coelogyne cristata3.33 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records40–402n range40median40mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 406×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Mehra, P. N. & S. K. Kashyap. 1989. Cytol. Orchids North-W. Himalayas Pramodh P. Kapur at Raj Bandhu Industrial Co., New Delhi.

CCDB · book-ipcn67-71 — TANAKA, R. 1971. Types of resting nuclei in Orchidaceae. Bot. Mag. (Tokyo) 84: 118-122.

CCDB · book-ipcn73-74

CCDB · book-indian_vol2 — Mehra, P.N. & Vij, S.P. 1970; Tanaka, R. 1971 ; Arp, G.K. 1973b ; Vij, S.P., Gupta, G.C. & Garg, A.K. 1976 ; Mehra, P.N. & Kashyap, S.K. 1978

CCDB · eflora

n 201×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — MEHRA, P.N., & S.P. VIJ. 1970. In IOPB chromosome number reports XXV. Taxon 19: 102-113.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type127 records

Wild obs. + sensor90

Museum / vouchered34

Cultivated / captive3

Range

Area of Occupancy AOO336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 25≤1 km 18≤10 km 7>10 km 4

54 georeferenced · 36 without coordinates

Open the mapobservation + sensor90

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤1 km 8>10 km 2

10 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence34

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	13
Beijing, CN	5
Blumenau, BR	2
Natural History Museum, Tribhuvan Universitylocation not on record	2
Kathmandu, NP	1
Vancouver, CA	1
Denver, US	1
Alcaldía Municipal de Garzón en Huilalocation not on record	1
Xining, CN	1
US	1
Museo naturalistico del Frignano Ferruccio Minghellilocation not on record	1
University of Alberta Museumslocation not on record	1

12 institutions · 30 of 34 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA23 detections

Where the DNA of Coelogyne cristata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)