Coeliopsis hyacinthosma — The Life Data

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Coeliopsis

At a glance

Occurrence records5

Data sources7

Biological traits10

DNA specimens8

eDNA detections6

Sources7 archives

Databases and archives Coeliopsis hyacinthosma's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF5 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Coeliopsis is a genus of orchids. The sole species is Coeliopsis hyacinthosma, native to Costa Rica, Panama, Colombia and Ecuador.Kew World Checklist of Selected Plant Families

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Woodinessnon-woody

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coeliopsis hyacinthosma has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes4

GenBank sequences9

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH766977.1 ↗357 bpGermany · 2017

ACGT

TGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCAGCCGGCCAAGGGCACGCCCGCCTGGGCGTCAAGCGTT …

Coeliopsis hyacinthosma voucher M:2000-2925 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK5rbcL2rbcLaITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type5 records

Museum / vouchered5

Range

Area of Occupancy AOO16 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence5

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pontificia Universidad Javeriana (PUJ)location not on record	2
Museo Nacional de Costa Rica (MNCR)location not on record	1
Saint Louis, US	1

3 institutions · 4 of 5 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Coeliopsis hyacinthosma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.