Coelia macrostachya

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Coelia

At a glance

Occurrence records169

Data sources8

Biological traits11

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Coelia macrostachya's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility169 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF169 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Coelia macrostachya is a species of orchid. It is native to Chiapas, Guatemala, Honduras, El Salvador, Panama, Guerrero, Oaxaca, Veracruz.Kew World Checklist of Selected Plant FamiliesHágsater, E. & G. A. Salazar. 1990. Orchids of Mexico, pt. 1. Icones Orchidacearum (Mexico) 1: plates 1–100.Dressler, R.L. 2003. Orchidaceae. En: Manual de Plantas de Costa Rica. Vol. 3. B.E. Hammel, M.H. Grayum, C. Herrera & N. Zamora (eds.). Monographs in systematic botany from the Missouri Botanical Garden 93: 1–595.D'Arcy, W.G. 1987. Flora of Panama. Checklist and Index. Part 1: The introduction and checklist. Monographs in systematic botany from the Missouri Botanical Garden 17: v–xxx, 1–328.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous epiphyte or lithophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max2 500 m

Elevation min1 000 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coelia macrostachya has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences6

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY008472.1 ↗646 bp

ACGT

TCGAGACCGAAATCTATCGAGCGATTCGGAGAACTCGTGAAATAAGCGACGGTTGCTGCTGTTGCGGAATAGCCGTCCCAGTCGTTGTAT …

Coelia macrostachya isolate MWC817 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type169 records

Wild obs. + sensor16

Museum / vouchered151

Other2

Range

Area of Occupancy AOO428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 9≤1 km 1≤10 km 1>10 km 2

13 georeferenced · 3 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 77≤1 km 1≤10 km 1

79 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence151

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	36
Mexico City, MX	28
Chicago, US	17
San Francisco, US	16
Harvard Universitylocation not on record	8
Saint Louis, US	7
CASlocation not on record	5
Austin, US	5
Tuxtla Gutiérrez, MX	4
Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record	3
California Academy of Scienceslocation not on record	3
Tuxtla Gutiérrez, MX	3
Station d'Ecologie de Lamtolocation not on record	3
Montecillo, Texcoco, MX	2
Instituto Chinoin, A.C.location not on record	2
Bronx, US	1
Denver, US	1
Escuela Agrícola Panamericanalocation not on record	1
Mérida, MX	1
GB	1
Antiguo Cuscatlán, SV	1
Madison, US	1

22 institutions · 149 of 151 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Coelia macrostachya was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)