Codonocarpus cotinifolius

(Desf.) F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Gyrostemonaceae/Codonocarpus

At a glance

Occurrence records1 729

Data sources8

Biological traits46

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Codonocarpus cotinifolius's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 729 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources46 traits

Occurrence & distributionGBIF1 729 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Codonocarpus cotinifolius a tall shrub or tree in the Gyrostemonaceae family is a found in all mainland states of Australia, including Victoria, and is widespread in arid areas. It is suspected of being toxic to stock. Common names are native poplar (New South Wales, Western Australia), and bell-fruit tree (Victoria) The species was first described in 1822 as Gyrostemon cotinifolium by René Louiche Desfontaines. In 1862 Ferdinand von Mueller transferred it to the genus, Codonocarpus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology21

Fruit length10 mm

Leaf length45 mm

Leaf length max60 mm

Leaf length min15 mm

Leaf mass per area106 g/m2

Leaf size350 mm²

Leaf width30 mm

Leaf width max50 mm

Leaf width min8 mm

Petiole length0.75 cm

Plant height10 m

Plant height max10 m

Plant height min2 m

Seed length3.5 mm

Seed mass2.75 mg

⚠ sources differ — TRY: 2.75 mg · AusTraits: 2.6 mg · GIFT: 2.47 mg

Seed mass max2.7 mg

Seed mass min2.23 mg

Seed volume2.3 mm³

Seed volume max2.3 mm³

Seed volume min2.3 mm³

Seed width2.31 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal+self

Flowering timennnyyyyyyynn

Life formshrub or tree

Life spanperennial < 20 years

⚠ sources differ — TRY: perennial < 20 years · AusTraits: perennial · GIFT: perennial

Lifespan years10 years

Pollination syndromewind

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeschizocarp

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapenarrowly_lanceolate obovate widely_ovate

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.03 mm²/mg

Wood density375 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Codonocarpus cotinifolius has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSDQ987074.1 ↗643 bp

ACGT

TCGAAATCTATCCAGAACAGGACGACCCGTGAACGTGTATTGAAACAAGGGATCGGTGGGCCTTAGGGACCATCGTTCCCTTCTCCGTGG …

Brassicales internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Codonocarpus cotinifolius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 144×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Keighery, G. J. 1975. Chromosome numbers in the Gyrostemonaceae Endl. and the Phytolaccaceae Lindl.: A comparison. Austral. J. Bot. 23: 335–338.

CCDB · ipcn-api-dl — Keighery, G. J. 1975a. In IOPB chromosome number reports XLIX. Taxon 24: 501–516.

CCDB · book-ipcn75-78 — Keighery 1975a

CCDB · book-ipcn75-78 — Keighery 1975

08Occurrence & distribution

Record type1 729 records

Wild obs. + sensor639

Museum / vouchered1 070

Cultivated / captive8

Other12

Origin

Native208

Range

Area of Occupancy AOO5 108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 331≤1 km 84≤10 km 96>10 km 18

529 georeferenced · 110 without coordinates

Open the mapobservation + sensor639

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 176≤1 km 128≤10 km 443>10 km 158

905 georeferenced · 165 without coordinates

Open the institutions mapphysical evidence1 070

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 2

4 georeferenced · 4 without coordinates

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	268
Kensington, AU	195
Museo Entomologico de Leonlocation not on record	161
Canberra, AU	125
Palmerston, AU	115
Brisbane, AU	79
Mount Annan, AU	44
Armidale, AU	14
Claremont, US	10
Kew, GB	8
Hobart, AU	5
John T. Waterhouse Herbariumlocation not on record	5
BGPAlocation not on record	5
Smithfield, AU	4
Parkville, AU	3
Stockholm, SE	3
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Beijing, CN	1
James Cook Townsvillelocation not on record	1
MAlocation not on record	1

20 institutions · 1 049 of 1 070 vouchered records shown · 21 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Codonocarpus cotinifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Codonocarpus cotinifolius

At a glance

Sources8 archives

Size & morphology21

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 729 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 729 records