Codon royenii

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Boraginales/Codonaceae/Codon

At a glance

Occurrence records143

Data sources7

Biological traits19

DNA specimens1

eDNA detections0

Sources7 archives

Databases and archives Codon royenii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility143 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF143 records

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Codon royenii là loài thực vật có hoa trong họ Mồ hôi. Loài này được L. mô tả khoa học đầu tiên năm 1767.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.44 m

Plant height min0.15 m

Seed mass1.4 mg

⚠ sources differ — TRY: 1.4 mg · GIFT: 1.55 mg

Seed mass max1.94 mg

Seed mass min1.4 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max2 000 m

Elevation min245 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)2.56 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Codon royenii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSKU927667.1 ↗655 bp

ACGT

GGGACCGAAGCGGGGGCTGGCTCGCCCTCCCTCGCCTCGGCCCCAAAGTCGTGGCGTTAAGCCCCGCAACAAACAAACCCCGGCGCGAGA …

Codon royenii isolate W2373 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Codon royenii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidypolyploid inferred

Chromosome records34–342n range34median34mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 342×CCDB · book-fedorov

CCDB · book-fedorov — Cave, Constance 1959

CCDB · book-fedorov — Constance 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type143 records

Wild obs. + sensor18

Museum / vouchered125

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 18 records without

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1>10 km 2

3 georeferenced · 122 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	102
Adam Mickiewicz University in Poznańlocation not on record	5
Cape Town, ZA	2
MSB-3054location not on record	2
Claremont, US	2
Saint Louis, US	2
Bronx, US	1
Kew, GB	1
Durban, ZA	1
Uppsala, SE	1

10 institutions · 119 of 125 vouchered records shown · 6 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)