Codium setchellii

N.L.Gardner · species

image placeholder — illustration coming later

Plantae/Chlorophyta/Ulvophyceae/Bryopsidales/Codiaceae/Codium

At a glance

Occurrence records1 708

Data sources7

Biological traits2

DNA specimens9

eDNA detections6

Sources7 archives

Databases and archives Codium setchellii's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 507 records↗

OBISOcean Biodiversity Information System201 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS1 708 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD · NCBI9 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Codium setchellii has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes2

GenBank sequences3

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLEF108072.1 ↗720 bpCanada

ACGT

GATTTAAAGCAGGTGTTAAAGATTACCGATTAACGTATTATACACCTGATTATCAAGTAAAAGAAACAGATATTCTTGCAGCTTTTCGTA …

Codium setchellii voucher CS01 ribulose-1,5-bisphosphate carboxylase/oxygenase, large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3tufA

plant barcodemarker

08Occurrence & distribution

Record type1 708 records

Wild obs. + sensor1 033

Museum / vouchered605

Other70

Range

Area of Occupancy AOO2 192 km²

Depth

0–200 m sunlit32

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 0 m · 32 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 392≤1 km 197≤10 km 32>10 km 19

640 georeferenced · 393 without coordinates

Open the mapobservation + sensor1 033

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 20≤1 km 100≤10 km 62>10 km 3

185 georeferenced · 420 without coordinates

Open the institutions mapphysical evidence605

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	224
US	42
Corvallis, US	33
WTUlocation not on record	27
Bronx, US	26
Ann Arbor, US	15
University of Stellenboschlocation not on record	13
Chapel Hill, US	11
Arcata, US	11
Durham, US	9
Friday Harbor Laboratories, University of Washingtonlocation not on record	9
Ciudad de México, MX	8
Los Angeles, US	8
Davis, US	7
Acadia Universitylocation not on record	4
San Diego, US	4
Edmonton, CA	3
LDlocation not on record	3
Ghent University, Herbariumlocation not on record	3
University of New Brunswick, Frederictonlocation not on record	3
McWane Science Centerlocation not on record	3
Minia, EG	2
Santa Cruz, US	1
Museo de Historia Natural, Universidad Autónoma de Baja California Surlocation not on record	1
Los Angeles, US	1
Auckland, NZ	1
Columbia, US	1
Puerto Ayora, EC	1
KMNlocation not on record	1
Irvine, US	1
Severin-McDaniel Insect Collectionlocation not on record	1
Centro Interdisciplinario de Ciencias Marinas, Instituto Politécnico Nacionallocation not on record	1
Fort Hayslocation not on record	1
Trondheim, NO	1

34 institutions · 480 of 605 vouchered records shown · 121 without an institution code

09Environmental DNA6 detections

Where the DNA of Codium setchellii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 3.70–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)15.0 °C 6.50–22.0

Min temp (night)9.40 °C 1.20–10.8

Precipitation34.7 mm/mo 19.4–96.5

Air humidity60.8 % 50.9–65.3

Moisture balance-93.3 mm/mo -115–5.50

Vapour deficit542 Pa 403–884

Wind speed3.60 m/s 2.90–4.80

Cloud cover32.9 % 25.5–47.3

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Codium setchellii

At a glance

Sources7 archives

Habitat & environment2

At a glance

Record type1 708 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions21 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 708 records