Codium reediae — The Life Data

Plantae/Chlorophyta/Ulvophyceae/Bryopsidales/Codiaceae/Codium

At a glance

Occurrence records288

Data sources6

Biological traits0

DNA specimens2

eDNA detections0

Sources6 archives

Databases and archives Codium reediae's data was compiled from.

GBIFGlobal Biodiversity Information Facility234 records↗

OBISOcean Biodiversity Information System54 records↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF · OBIS288 records

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Codium reediae has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences5

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLPV797681.1 ↗706 bpUSA · 2011

ACGT

CCGACTAACTTATTATACACCTGATTATCAAGTTAAAGAAACTGATATTCTTGCAGCTTTTCGTATGACTCCGCAACCTGGAGTTCCACC …

Codium reediae voucher BISH:799594 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL5

plant barcode

08Occurrence & distribution

Record type288 records

Wild obs. + sensor7

Museum / vouchered277

Other4

Range

Area of Occupancy AOO384 km²

Depth

0–200 m sunlit10

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.8 m · max 3.6 m · 10 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 5>10 km 1

6 georeferenced · 1 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 50≤1 km 32≤10 km 34>10 km 3

119 georeferenced · 158 without coordinates

Open the institutions mapphysical evidence277

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Honolulu, US	88
BISHlocation not on record	84
Ann Arbor, US	13
University of Stellenboschlocation not on record	4
University of Hawaii at Manoalocation not on record	2
Ghent University, Herbariumlocation not on record	2
San Diego, US	2
Bronx, US	1
Tampa, US	1
Durham, US	1
MeiseBGlocation not on record	1
Corvallis, US	1

12 institutions · 200 of 277 vouchered records shown · 28 without an institution code