Codium mamillosum

Harv. · species

image placeholder — illustration coming later

Plantae/Chlorophyta/Ulvophyceae/Bryopsidales/Codiaceae/Codium

At a glance

Occurrence records490

Data sources7

Biological traits0

DNA specimens3

eDNA detections0

Sources7 archives

Databases and archives Codium mamillosum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility333 records↗

OBISOcean Biodiversity Information System157 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS490 records

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Codium mamillosum is a species of seaweed in the Codiaceae family. The medium green globose thallus has a diameter of around 8 cm that is attached to a tuft of rhizoids. It is found from low tidal areas to a depth of 40 m sublittoral zone in moderate water coasts. In Western Australia is found along the coast in the Mid West region extending along the south coast and along the east coast of Victoria. The species is also found around Hawaii and Japan.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Codium mamillosum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences3

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLPV797744.1 ↗706 bpUSA · 2014

ACGT

CCGATTAACTTATTATACACCGGATTATCAAGTAAAAGAAACAGATATTCTTGCAGCTTTTCGTATGACCCCTCAACCTGGAGTTCCTCC …

Codium mamillosum voucher BISH:799568 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3

plant barcode

08Occurrence & distribution

Record type490 records

Wild obs. + sensor235

Museum / vouchered218

Other37

Origin

Native7

Range

Area of Occupancy AOO772 km²

Depth

0–200 m sunlit98

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 15 m · max 181.8 m · 98 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 78≤1 km 115≤10 km 6>10 km 3

202 georeferenced · 33 without coordinates

Open the mapobservation + sensor235

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 18≤1 km 21≤10 km 93>10 km 4

136 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence218

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	52
Honolulu, US	25
BISHlocation not on record	24
University of Stellenboschlocation not on record	22
Kensington, AU	13
Museo Entomologico de Leonlocation not on record	10
Mount Annan, AU	7
Ghent University, Herbariumlocation not on record	5
Bronx, US	4
Brisbane, AU	4
Ann Arbor, US	3
Acadia Universitylocation not on record	2
Hobart, AU	2
LDlocation not on record	2
WTUlocation not on record	1
University of Hawaii at Manoalocation not on record	1
Chapel Hill, US	1
Auckland, NZ	1
San Diego, US	1
Canberra, AU	1

20 institutions · 181 of 218 vouchered records shown · 18 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)