Codium galeatum

J.Agardh, 1887 · species

image placeholder — illustration coming later

Plantae/Chlorophyta/Ulvophyceae/Bryopsidales/Codiaceae/Codium

At a glance

Occurrence records689

Data sources6

Biological traits2

DNA specimens16

eDNA detections2

Sources6 archives

Databases and archives Codium galeatum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility483 records↗

OBISOcean Biodiversity Information System206 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

NCBIUS National Library of Medicinesequences↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS689 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI16 specimens

01Narrative

Codium galeatum is a species of seaweed in the Codiaceae family. The firm, erect medium green thallus with regular dichotomous branches typically grows to a height of 1 m. It is commonly found on rough water coasts from the low tide mark to a depth of 37 m. In Western Australia it is found along the coast in Mid West, extending down to the southern coast. It extends as far as Ballina in New South Wales and is found along Tasmanian coasts.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Codium galeatum has left across the world's sequence archives.

At a glance

DNA specimens16

Marker genes1

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKP686008.1 ↗729 bp

ACGT

CGACTAACCTATTATACACCTGATTATCAAGTTAAAGAAACTGACATTCTTGCAGCTTTTCGTATGACTCCACAACCTGGAGTTCCACCA …

Codium galeatum voucher JFC0179 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3

plant barcode

08Occurrence & distribution

Record type689 records

Wild obs. + sensor200

Museum / vouchered412

Cultivated / captive62

Other15

Origin

Native6

Range

Area of Occupancy AOO836 km²

Depth

0–200 m sunlit38

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 24.8 m · max 47 m · 38 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 190≤1 km 3≤10 km 2>10 km 2

197 georeferenced · 3 without coordinates

Open the mapobservation + sensor200

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤100 m 5≤1 km 21≤10 km 314>10 km 12

352 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence412

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 62

62 georeferenced

Open the mapnot free-living62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	199
Kensington, AU	60
Museo Entomologico de Leonlocation not on record	33
Brisbane, AU	16
Ghent University, Herbariumlocation not on record	13
LDlocation not on record	8
Bronx, US	5
MeiseBGlocation not on record	5
Ann Arbor, US	5
Hobart, AU	5
Parkville, AU	5
Mount Annan, AU	4
GRAlocation not on record	4
Australian Institute of Marine Sciencelocation not on record	3
Canberra, AU	2
Wellington, NZ	2
Chapel Hill, US	2
James Cook Townsvillelocation not on record	1
Auckland, NZ	1
Burlington, US	1
Durham, US	1
WTUlocation not on record	1
Tampa, US	1

23 institutions · 377 of 412 vouchered records shown · 28 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Codium galeatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)