Codium edule — The Life Data

Plantae/Chlorophyta/Ulvophyceae/Bryopsidales/Codiaceae/Codium

At a glance

Occurrence records662

Data sources7

Biological traits5

DNA specimens3

eDNA detections0

Sources7 archives

Databases and archives Codium edule's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility525 records↗

OBISOcean Biodiversity Information System137 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS662 records

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Codium edule is a green alga common on shallow reef flats from the intertidal to the subtidal in tropical waters of the Indo-Pacific. The species is common in Hawaiʻi where it is usually called wāwaeʻiole (meaning "ratʻs foot") and considered an edible alga or limu. Prominent ethnobotanist, Isabella Abbott, described its usage in her writing.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max48 m

Depth min2 m

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Codium edule has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMW275867.1 ↗514 bp

ACGT

TTTCGTATGACTCCACAACCTGGAGTTCCACCCGAAGAATGTGGCGCTGCTGTTGCTGCTGAATCTTCTACTGGTACATGGACTACAGTT …

Codium edule ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL10

plant barcode

08Occurrence & distribution

Record type662 records

Wild obs. + sensor62

Museum / vouchered592

Other8

Range

Area of Occupancy AOO880 km²

Depth

0–200 m sunlit49

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 56 m · 49 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy5% within 1 km

≤100 m 1≤1 km 1>10 km 39

41 georeferenced · 21 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 114≤1 km 56≤10 km 73>10 km 18

261 georeferenced · 331 without coordinates

Open the institutions mapphysical evidence592

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Honolulu, US	167
BISHlocation not on record	154
Ann Arbor, US	24
University of Stellenboschlocation not on record	22
Bronx, US	9
Ciudad de México, MX	5
University of Hawaii at Manoalocation not on record	4
MeiseBGlocation not on record	4
Durham, US	4
Tampa, US	3
Chapel Hill, US	3
San Diego, US	3
Ghent University, Herbariumlocation not on record	2
Corvallis, US	2
Mexico City, MX	1
Butler Universitylocation not on record	1
Champaign, US	1
LDlocation not on record	1
Minia, EG	1
McWane Science Centerlocation not on record	1

20 institutions · 412 of 592 vouchered records shown · 71 without an institution code