Codium cranwelliae

Setch. · species

image placeholder — illustration coming later

Plantae/Chlorophyta/Ulvophyceae/Bryopsidales/Codiaceae/Codium

At a glance

Occurrence records89

Data sources6

Biological traits2

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Codium cranwelliae's data was compiled from.

GBIFGlobal Biodiversity Information Facility86 records↗

OBISOcean Biodiversity Information System3 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS89 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Codium cranwelliae has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKP685993.1 ↗601 bp

ACGT

AGCAGGTGCAGGTTTTAAAGCAGGAGTTAAAGATTACCGATTAACTTATTATACACCGGATTATCAAGTAAAAGAAACAGATATTCTTGC …

Codium cranwelliae voucher H.0772 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

08Occurrence & distribution

Record type89 records

Wild obs. + sensor19

Museum / vouchered69

Other1

Origin

Native2

Range

Area of Occupancy AOO192 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 9.5 m · max 9.5 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 16≤1 km 1≤10 km 2

19 georeferenced

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 2≤1 km 10≤10 km 5>10 km 3

20 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence69

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	30
Auckland, NZ	18
WTUlocation not on record	3
Ghent University, Herbariumlocation not on record	3
Chapel Hill, US	3
Mount Annan, AU	2
University of Stellenboschlocation not on record	1
Christchurch, NZ	1

8 institutions · 61 of 69 vouchered records shown · 7 without an institution code

09Environmental DNA1 detections

Where the DNA of Codium cranwelliae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 5.70–5.70

Seasonal swing summer↔winter12.3 °C

Max temp (day)9.20 °C

Min temp (night)1.40 °C

Precipitation130 mm/mo

Air humidity62.6 %

Moisture balance54.3 mm/mo

Vapour deficit357 Pa

Wind speed5.90 m/s

Cloud cover38.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)