Codium bursa

(Olivi) C.Agardh · species

image placeholder — illustration coming later

Plantae/Chlorophyta/Ulvophyceae/Bryopsidales/Codiaceae/Codium

At a glance

Occurrence records8 049

Data sources8

Biological traits4

DNA specimens6

eDNA detections4

Sources8 archives

Databases and archives Codium bursa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 205 records↗

OBISOcean Biodiversity Information System844 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS8 049 records

Environmental DNA1 datasets · 3 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Codium bursa is a green marine algae of medium size.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max90 m

Depth min40 m

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Codium bursa has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes1

GenBank sequences3

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLEF107972.1 ↗743 bpSpain

ACGT

GATTTAAAGCAGGAGTAAAAGATTACCGACTAACTTATTATACACCGGATTATCAAGTTAAAGAAACGGATATTCTTGCAGCTTTTCGTA …

Codium bursa voucher HV883 (GENT) ribulose-1,5-bisphosphate carboxylase/oxygenase, large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3

plant barcode

08Occurrence & distribution

Record type8 049 records

Wild obs. + sensor6 847

Museum / vouchered150

Other1 052

Origin

Native232

Range

Area of Occupancy AOO5 468 km²

Depth

0–200 m sunlit645

200–1000 m twilight56

1–4 km midnight0

>4 km abyssal0

median 55.2 m · max 734 m · 701 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 792≤1 km 649≤10 km 88>10 km 16

1 545 georeferenced · 5 302 without coordinates

Open the mapobservation + sensor6 847

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 5≤1 km 6≤10 km 35>10 km 13

59 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence150

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	36
Tartu Fungal Culture Collectionlocation not on record	17
Bronx, US	9
Universidad de Málagalocation not on record	9
Ann Arbor, US	8
RUGlocation not on record	5
LDlocation not on record	4
Ghent University, Herbariumlocation not on record	3
New Haven, US	3
University of Stellenboschlocation not on record	3
Barcelona, ES	2
MeiseBGlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Durham, US	1
Butler Universitylocation not on record	1
Kensington, AU	1
Durham, US	1

17 institutions · 107 of 150 vouchered records shown · 32 without an institution code

09Environmental DNA4 detections

Where the DNA of Codium bursa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 11.8–24.6

Seasonal swing summer↔winter21.2 °C

Max temp (day)18.1 °C 16.2–30.5

Min temp (night)7.70 °C 6.50–17.4

Precipitation59.8 mm/mo 12.4–86.2

Air humidity57.7 % 47.3–62.5

Moisture balance-23.7 mm/mo -157–14.3

Vapour deficit771 Pa 590–1,902

Wind speed1.90 m/s 1.80–3.60

Cloud cover41.2 % 18.7–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Codium bursa

At a glance

Sources8 archives

Habitat & environment2

Other traits2

At a glance

Record type8 049 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 049 records