Cochlospermum fraseri

Planch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Cochlospermaceae/Cochlospermum

At a glance

Occurrence records2 759

Data sources7

Biological traits43

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Cochlospermum fraseri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 759 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources43 traits

Occurrence & distributionGBIF2 759 records

DNA & barcodingNCBIsequences

01Narrative

Cochlospermum fraseri is a tree in the family Bixaceae with common names cotton tree, kapok bush, and kapok tree. It is native to north western Australia (in Western Australia and the Northern Territory).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology16

Fruit length67.5 mm

Fruit width41.5 mm

Leaf length75 mm

Leaf mass302 mg

Leaf mass per area55.79 g/m2

Leaf size5 499 mm²

Leaf width110 mm

Petiole length13 cm

Plant height4 m

⚠ sources differ — GIFT: 4 m · AusTraits: 6 m · TRY: 5.25 m

Plant height max6 m

Plant height min1 m

Seed length6.5 mm

Seed mass41.2 mg

⚠ sources differ — TRY: 41.2 mg · AusTraits: 38.84 mg · GIFT: 36.47 mg

Seed mass max36.47 mg

Seed mass min36.47 mg

Seed width4.25 mm

Life cycle & reproduction8

Deciduousnessevergreen

⚠ sources differ — TRY: evergreen · GIFT: deciduous

Dispersal typewind

Flowering timennnnyyyyyynn

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: tree · TRY: savanna

Leaf compoundnesssimple

Leaf shapeovate

Mycorrhiza typenon-ectomycorrhizal

Woodinesswoody

Physiology & chemistry7

Leaf c422 mg/g

Leaf n16.66 mg/g

Leaf p0.837 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)15.64 mm²/mg

Wood density318 mg/cm³

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cochlospermum fraseri has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKY670813.1 ↗746 bpAustralia

ACGT

AGGAGGCGAATAACTATACGAATTTTAGAGTCGCCCATCAGGGCGGACTGGACCCCAGCGGTACGGCCCCGTCGCGAGTCCTCGAGGGTT …

Cochlospermum fraseri isolate Cfras46Australia internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type2 759 records

Wild obs. + sensor2 544

Museum / vouchered208

Cultivated / captive4

Other3

Origin

Native4

Range

Area of Occupancy AOO6 452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 462≤1 km 75≤10 km 34>10 km 40

1 611 georeferenced · 933 without coordinates

Open the mapobservation + sensor2 544

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 24≤1 km 16≤10 km 91>10 km 20

151 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence208

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	106
Adelaide, AU	23
Museo Entomologico de Leonlocation not on record	20
Palmerston, AU	13
Brisbane, AU	11
Canberra, AU	9
BGPAlocation not on record	7
Hobart, AU	3
Smithfield, AU	3
John T. Waterhouse Herbariumlocation not on record	2
Kew, GB	2
University of Stellenboschlocation not on record	2
EL PASO, US	1
Saint Louis, US	1

14 institutions · 203 of 208 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cochlospermum fraseri

At a glance

Sources7 archives

Size & morphology16

Life cycle & reproduction8

Diet & foraging1

Habitat & environment11

Physiology & chemistry7

At a glance

Record type2 759 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 14 geolocated

Cultivated / Captivenot free-living

Record type2 759 records